Incidental Mutation 'R3712:Nedd4l'
ID259701
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 040705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R3712 (G1)
Quality Score215
Status Validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65209719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 909 (V909I)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect probably benign
Transcript: ENSMUST00000080418
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: V788I

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163516
AA Change: V909I

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V909I

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224347
AA Change: V768I

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably benign
Transcript: ENSMUST00000226058
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1459 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,627,523 V27F unknown Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Alx4 G A 2: 93,642,789 G44D possibly damaging Het
Arhgap31 T A 16: 38,602,533 E1057V possibly damaging Het
Arhgef26 A T 3: 62,423,629 D588V probably damaging Het
Bag2 T A 1: 33,746,916 E108D probably benign Het
Ccdc162 C T 10: 41,587,379 V183I probably benign Het
Ccdc58 T C 16: 36,081,405 probably null Het
Ccdc83 A G 7: 90,236,355 probably benign Het
Ccnyl1 G A 1: 64,714,668 E137K probably damaging Het
Celsr2 T C 3: 108,400,839 T1849A probably benign Het
Cep192 C A 18: 67,820,329 D472E probably benign Het
Cep57l1 A G 10: 41,743,114 Y86H probably damaging Het
Cep95 G T 11: 106,811,286 E370* probably null Het
Cldn10 A G 14: 118,855,110 T41A probably damaging Het
Clptm1l T A 13: 73,616,038 Y426N probably benign Het
Eps15 T C 4: 109,309,177 V89A probably damaging Het
Fam53b A G 7: 132,759,925 S125P probably damaging Het
Fam69b T C 2: 26,632,638 L33S possibly damaging Het
Fbxo44 A T 4: 148,156,004 W256R probably benign Het
Gnl2 T C 4: 125,046,274 V313A probably damaging Het
Hyal4 A G 6: 24,756,514 R244G probably damaging Het
Irf6 G T 1: 193,162,623 W134L probably benign Het
Kcnu1 A G 8: 25,881,420 T286A probably damaging Het
Lpcat2 T C 8: 92,918,170 V529A possibly damaging Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp8 G T 4: 107,848,302 R209L probably benign Het
Mgll T C 6: 88,764,588 probably benign Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr411 A T 11: 74,347,197 I129N probably damaging Het
Olfr490 A T 7: 108,286,456 Y223* probably null Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Orc1 T C 4: 108,604,021 V526A probably damaging Het
Pard3b T C 1: 62,343,978 S744P probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pdcd11 T A 19: 47,127,245 probably benign Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Pigt A G 2: 164,501,645 D347G probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Rpl7a-ps10 A G 9: 97,179,873 E232G probably damaging Het
Rprd2 A G 3: 95,764,560 L1177P probably damaging Het
Rrn3 T A 16: 13,784,095 L71* probably null Het
Sbspon A G 1: 15,892,445 C70R probably damaging Het
Smtn A T 11: 3,532,865 probably null Het
Son A G 16: 91,656,726 D787G probably damaging Het
Sphkap C T 1: 83,277,112 S972N probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Srp14 A C 2: 118,478,959 L58V probably null Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trdn T C 10: 33,157,166 I129T probably benign Het
Trpv3 A G 11: 73,278,954 K117R probably benign Het
Ubqlnl A T 7: 104,149,138 I384N probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r59 A T 7: 5,454,638 I41K probably damaging Het
Vmn2r125 T A 4: 156,350,124 Y68* probably null Het
Zpld1 A T 16: 55,226,436 L390* probably null Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense not run
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGGGATTGTAGCGAC -3'
(R):5'- GTTGAAGCCCTCTGTTCTGC -3'

Sequencing Primer
(F):5'- AGACAATGCCGGTCTTGG -3'
(R):5'- GCATCTCCGTGGGTCTCTG -3'
Posted On2015-01-23