Incidental Mutation 'R3712:Nedd4l'
ID 259701
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 040705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R3712 (G1)
Quality Score 215
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65342790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 909 (V909I)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080418
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: V788I

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163516
AA Change: V909I

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V909I

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224347
AA Change: V768I

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably benign
Transcript: ENSMUST00000226058
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1459 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,424,411 (GRCm39) V27F unknown Het
Akr1c20 T C 13: 4,560,222 (GRCm39) E152G probably damaging Het
Alx4 G A 2: 93,473,134 (GRCm39) G44D possibly damaging Het
Arhgap31 T A 16: 38,422,895 (GRCm39) E1057V possibly damaging Het
Arhgef26 A T 3: 62,331,050 (GRCm39) D588V probably damaging Het
Bag2 T A 1: 33,785,997 (GRCm39) E108D probably benign Het
Ccdc162 C T 10: 41,463,375 (GRCm39) V183I probably benign Het
Ccdc83 A G 7: 89,885,563 (GRCm39) probably benign Het
Ccnyl1 G A 1: 64,753,827 (GRCm39) E137K probably damaging Het
Celsr2 T C 3: 108,308,155 (GRCm39) T1849A probably benign Het
Cep192 C A 18: 67,953,400 (GRCm39) D472E probably benign Het
Cep57l1 A G 10: 41,619,110 (GRCm39) Y86H probably damaging Het
Cep95 G T 11: 106,702,112 (GRCm39) E370* probably null Het
Cldn10 A G 14: 119,092,522 (GRCm39) T41A probably damaging Het
Clptm1l T A 13: 73,764,157 (GRCm39) Y426N probably benign Het
Dipk1b T C 2: 26,522,650 (GRCm39) L33S possibly damaging Het
Eps15 T C 4: 109,166,374 (GRCm39) V89A probably damaging Het
Fam53b A G 7: 132,361,654 (GRCm39) S125P probably damaging Het
Fbxo44 A T 4: 148,240,461 (GRCm39) W256R probably benign Het
Gnl2 T C 4: 124,940,067 (GRCm39) V313A probably damaging Het
Hyal4 A G 6: 24,756,513 (GRCm39) R244G probably damaging Het
Irf6 G T 1: 192,844,931 (GRCm39) W134L probably benign Het
Kcnu1 A G 8: 26,371,448 (GRCm39) T286A probably damaging Het
Lpcat2 T C 8: 93,644,798 (GRCm39) V529A possibly damaging Het
Lrfn2 A G 17: 49,378,188 (GRCm39) E423G possibly damaging Het
Lrp8 G T 4: 107,705,499 (GRCm39) R209L probably benign Het
Mgll T C 6: 88,741,570 (GRCm39) probably benign Het
Mix23 T C 16: 35,901,775 (GRCm39) probably null Het
Mta3 A G 17: 84,070,417 (GRCm39) I193V probably damaging Het
Or10al5 T A 17: 38,063,271 (GRCm39) C175* probably null Het
Or3a1d A T 11: 74,238,023 (GRCm39) I129N probably damaging Het
Or5p66 A T 7: 107,885,663 (GRCm39) Y223* probably null Het
Or6c206 A T 10: 129,097,093 (GRCm39) K88* probably null Het
Orc1 T C 4: 108,461,218 (GRCm39) V526A probably damaging Het
Pard3b T C 1: 62,383,137 (GRCm39) S744P probably damaging Het
Pcnx3 G A 19: 5,733,367 (GRCm39) Q155* probably null Het
Pcnx3 C G 19: 5,733,368 (GRCm39) L1F probably null Het
Pdcd11 T A 19: 47,115,684 (GRCm39) probably benign Het
Pi4k2a G A 19: 42,079,131 (GRCm39) R64Q probably damaging Het
Pigt A G 2: 164,343,565 (GRCm39) D347G probably benign Het
Rbm27 T C 18: 42,425,177 (GRCm39) probably benign Het
Rpl7a-ps10 A G 9: 97,061,926 (GRCm39) E232G probably damaging Het
Rprd2 A G 3: 95,671,872 (GRCm39) L1177P probably damaging Het
Rrn3 T A 16: 13,601,959 (GRCm39) L71* probably null Het
Sbspon A G 1: 15,962,669 (GRCm39) C70R probably damaging Het
Smtn A T 11: 3,482,865 (GRCm39) probably null Het
Son A G 16: 91,453,614 (GRCm39) D787G probably damaging Het
Sphkap C T 1: 83,254,833 (GRCm39) S972N probably benign Het
Spopl C T 2: 23,427,392 (GRCm39) R221Q probably damaging Het
Srp14 A C 2: 118,309,440 (GRCm39) L58V probably null Het
Sun2 A G 15: 79,612,114 (GRCm39) S522P possibly damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Trdn T C 10: 33,033,162 (GRCm39) I129T probably benign Het
Trpv3 A G 11: 73,169,780 (GRCm39) K117R probably benign Het
Ubqlnl A T 7: 103,798,345 (GRCm39) I384N probably benign Het
Ush2a G A 1: 188,542,489 (GRCm39) G3352S probably benign Het
Vmn1r59 A T 7: 5,457,637 (GRCm39) I41K probably damaging Het
Vmn2r125 T A 4: 156,702,419 (GRCm39) Y68* probably null Het
Zpld1 A T 16: 55,046,799 (GRCm39) L390* probably null Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGGGATTGTAGCGAC -3'
(R):5'- GTTGAAGCCCTCTGTTCTGC -3'

Sequencing Primer
(F):5'- AGACAATGCCGGTCTTGG -3'
(R):5'- GCATCTCCGTGGGTCTCTG -3'
Posted On 2015-01-23