Incidental Mutation 'R3712:Pi4k2a'
ID259705
Institutional Source Beutler Lab
Gene Symbol Pi4k2a
Ensembl Gene ENSMUSG00000025178
Gene Namephosphatidylinositol 4-kinase type 2 alpha
Synonyms
MMRRC Submission 040705-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R3712 (G1)
Quality Score138
Status Validated
Chromosome19
Chromosomal Location42090435-42122218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42090692 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 64 (R64Q)
Ref Sequence ENSEMBL: ENSMUSP00000069284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051772] [ENSMUST00000066778]
Predicted Effect probably benign
Transcript: ENSMUST00000051772
SMART Domains Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

DomainStartEndE-ValueType
MORN 14 35 1.64e-5 SMART
MORN 37 58 4.15e-2 SMART
MORN 60 81 1.86e-4 SMART
MORN 83 104 1.84e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066778
AA Change: R64Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: R64Q

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
Pfam:PI3_PI4_kinase 133 431 1.7e-67 PFAM
Meta Mutation Damage Score 0.2657 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,627,523 V27F unknown Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Alx4 G A 2: 93,642,789 G44D possibly damaging Het
Arhgap31 T A 16: 38,602,533 E1057V possibly damaging Het
Arhgef26 A T 3: 62,423,629 D588V probably damaging Het
Bag2 T A 1: 33,746,916 E108D probably benign Het
Ccdc162 C T 10: 41,587,379 V183I probably benign Het
Ccdc58 T C 16: 36,081,405 probably null Het
Ccdc83 A G 7: 90,236,355 probably benign Het
Ccnyl1 G A 1: 64,714,668 E137K probably damaging Het
Celsr2 T C 3: 108,400,839 T1849A probably benign Het
Cep192 C A 18: 67,820,329 D472E probably benign Het
Cep57l1 A G 10: 41,743,114 Y86H probably damaging Het
Cep95 G T 11: 106,811,286 E370* probably null Het
Cldn10 A G 14: 118,855,110 T41A probably damaging Het
Clptm1l T A 13: 73,616,038 Y426N probably benign Het
Eps15 T C 4: 109,309,177 V89A probably damaging Het
Fam53b A G 7: 132,759,925 S125P probably damaging Het
Fam69b T C 2: 26,632,638 L33S possibly damaging Het
Fbxo44 A T 4: 148,156,004 W256R probably benign Het
Gnl2 T C 4: 125,046,274 V313A probably damaging Het
Hyal4 A G 6: 24,756,514 R244G probably damaging Het
Irf6 G T 1: 193,162,623 W134L probably benign Het
Kcnu1 A G 8: 25,881,420 T286A probably damaging Het
Lpcat2 T C 8: 92,918,170 V529A possibly damaging Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp8 G T 4: 107,848,302 R209L probably benign Het
Mgll T C 6: 88,764,588 probably benign Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr411 A T 11: 74,347,197 I129N probably damaging Het
Olfr490 A T 7: 108,286,456 Y223* probably null Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Orc1 T C 4: 108,604,021 V526A probably damaging Het
Pard3b T C 1: 62,343,978 S744P probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pdcd11 T A 19: 47,127,245 probably benign Het
Pigt A G 2: 164,501,645 D347G probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Rpl7a-ps10 A G 9: 97,179,873 E232G probably damaging Het
Rprd2 A G 3: 95,764,560 L1177P probably damaging Het
Rrn3 T A 16: 13,784,095 L71* probably null Het
Sbspon A G 1: 15,892,445 C70R probably damaging Het
Smtn A T 11: 3,532,865 probably null Het
Son A G 16: 91,656,726 D787G probably damaging Het
Sphkap C T 1: 83,277,112 S972N probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Srp14 A C 2: 118,478,959 L58V probably null Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trdn T C 10: 33,157,166 I129T probably benign Het
Trpv3 A G 11: 73,278,954 K117R probably benign Het
Ubqlnl A T 7: 104,149,138 I384N probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r59 A T 7: 5,454,638 I41K probably damaging Het
Vmn2r125 T A 4: 156,350,124 Y68* probably null Het
Zpld1 A T 16: 55,226,436 L390* probably null Het
Other mutations in Pi4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Pi4k2a APN 19 42104979 missense probably damaging 1.00
IGL02959:Pi4k2a APN 19 42113071 missense probably benign 0.42
R1570:Pi4k2a UTSW 19 42100644 missense probably benign 0.33
R1992:Pi4k2a UTSW 19 42115938 missense probably damaging 1.00
R2113:Pi4k2a UTSW 19 42115071 missense possibly damaging 0.78
R2358:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R2410:Pi4k2a UTSW 19 42104877 missense possibly damaging 0.55
R3547:Pi4k2a UTSW 19 42090548 missense probably benign 0.10
R3708:Pi4k2a UTSW 19 42090931 nonsense probably null
R3954:Pi4k2a UTSW 19 42115899 missense probably damaging 0.98
R4654:Pi4k2a UTSW 19 42113105 critical splice donor site probably null
R5077:Pi4k2a UTSW 19 42119836 unclassified probably null
R5386:Pi4k2a UTSW 19 42090515 missense probably damaging 0.99
R5846:Pi4k2a UTSW 19 42115038 missense probably benign 0.01
R5867:Pi4k2a UTSW 19 42105485 critical splice donor site probably null
R5878:Pi4k2a UTSW 19 42100641 missense probably benign 0.02
R6502:Pi4k2a UTSW 19 42090932 missense probably benign 0.04
R7042:Pi4k2a UTSW 19 42104898 missense probably benign 0.18
R7269:Pi4k2a UTSW 19 42090686 missense probably damaging 1.00
R7819:Pi4k2a UTSW 19 42090574 missense probably benign
Z1177:Pi4k2a UTSW 19 42104925 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGCCAAGTAAACAGGACAG -3'
(R):5'- ATAGATGCTGCACTCGATGG -3'

Sequencing Primer
(F):5'- AGACGAGCCCGCTAGTGTC -3'
(R):5'- TGCACTCGATGGCAACCTC -3'
Posted On2015-01-23