Incidental Mutation 'R3713:Lmbrd1'
ID259708
Institutional Source Beutler Lab
Gene Symbol Lmbrd1
Ensembl Gene ENSMUSG00000073725
Gene NameLMBR1 domain containing 1
Synonyms0910001K20Rik
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3713 (G1)
Quality Score208
Status Validated
Chromosome1
Chromosomal Location24678630-24766301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24692995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 98 (Y98H)
Ref Sequence ENSEMBL: ENSMUSP00000140783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095062] [ENSMUST00000186096] [ENSMUST00000186190] [ENSMUST00000191471]
Predicted Effect probably damaging
Transcript: ENSMUST00000095062
AA Change: Y28H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092672
Gene: ENSMUSG00000073725
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:LMBR1 17 292 3e-24 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186096
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140911
Gene: ENSMUSG00000073725
AA Change: Y98H

DomainStartEndE-ValueType
Pfam:LMBR1 12 155 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186190
SMART Domains Protein: ENSMUSP00000139893
Gene: ENSMUSG00000073725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191471
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140783
Gene: ENSMUSG00000073725
AA Change: Y98H

DomainStartEndE-ValueType
Pfam:LMBR1 12 289 2.7e-19 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Meta Mutation Damage Score 0.6454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice heterozygous for a targeted allele exhibit increased cardiac cell glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Lmbrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Lmbrd1 APN 1 24705974 splice site probably benign
IGL01897:Lmbrd1 APN 1 24743896 missense possibly damaging 0.47
IGL01950:Lmbrd1 APN 1 24711602 critical splice donor site probably null
IGL02342:Lmbrd1 APN 1 24704878 missense probably damaging 1.00
IGL02888:Lmbrd1 APN 1 24714972 missense possibly damaging 0.94
P0033:Lmbrd1 UTSW 1 24685565 missense possibly damaging 0.95
R0479:Lmbrd1 UTSW 1 24746797 splice site probably benign
R0549:Lmbrd1 UTSW 1 24744920 missense probably benign 0.17
R1015:Lmbrd1 UTSW 1 24731878 nonsense probably null
R1423:Lmbrd1 UTSW 1 24746878 missense probably damaging 0.99
R1636:Lmbrd1 UTSW 1 24746930 nonsense probably null
R1650:Lmbrd1 UTSW 1 24711558 missense probably damaging 0.97
R1815:Lmbrd1 UTSW 1 24685561 missense possibly damaging 0.55
R2354:Lmbrd1 UTSW 1 24685541 missense probably damaging 1.00
R3690:Lmbrd1 UTSW 1 24762293 makesense probably null
R4241:Lmbrd1 UTSW 1 24692968 nonsense probably null
R4627:Lmbrd1 UTSW 1 24705999 missense probably damaging 1.00
R4782:Lmbrd1 UTSW 1 24744975 splice site probably null
R4799:Lmbrd1 UTSW 1 24744975 splice site probably null
R5341:Lmbrd1 UTSW 1 24746811 nonsense probably null
R5430:Lmbrd1 UTSW 1 24692980 missense possibly damaging 0.95
R5483:Lmbrd1 UTSW 1 24744908 missense probably damaging 1.00
R5633:Lmbrd1 UTSW 1 24748862 missense possibly damaging 0.90
R6188:Lmbrd1 UTSW 1 24711545 missense probably benign
R6383:Lmbrd1 UTSW 1 24706034 missense probably damaging 0.99
R6617:Lmbrd1 UTSW 1 24685428 missense probably damaging 1.00
R7060:Lmbrd1 UTSW 1 24692966 missense probably benign 0.00
R7365:Lmbrd1 UTSW 1 24744867 missense possibly damaging 0.62
R7621:Lmbrd1 UTSW 1 24728544 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCATCTACTAACAGGCTTCAGAG -3'
(R):5'- TGGGAACGCGCTGACTTAAC -3'

Sequencing Primer
(F):5'- CAGGCTTCAGAGATGAAATTCAGTC -3'
(R):5'- CCCCTCAAGAAGTGTTACATGTG -3'
Posted On2015-01-23