Incidental Mutation 'R3713:Aox1'
ID259709
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58056215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 196 (T196I)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably benign
Transcript: ENSMUST00000001027
AA Change: T196I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: T196I

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160168
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGAGTATGTTGCAAAGATTTACCA -3'
(R):5'- GCCTGTTTGCCCATCAGTAT -3'

Sequencing Primer
(F):5'- TGTTGCAAAGATTTACCATAAGAATG -3'
(R):5'- CAGCCTTTAACTAGCGACAGTGTG -3'
Posted On2015-01-23