Mutagenetix > Incidental Mutations

Incidental Mutation 'R3713:Astn1'

259711

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

040706-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R3713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158362273-158691781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158667532 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1042 (E1042G)

Ref Sequence

ENSEMBL: ENSMUSP00000039711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000192821] [ENSMUST00000193042] [ENSMUST00000195311]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046110
AA Change: E1042G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: E1042G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192821
AA Change: E66G

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141260
Gene: ENSMUSG00000026587
AA Change: E66G

Domain	Start	End	E-Value	Type
FN3	46	158	2.8e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193042
AA Change: E1050G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: E1050G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194217

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195311
AA Change: E1042G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: E1042G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Meta Mutation Damage Score

0.1636

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	T	C	16: 88,627,193	M137V	probably benign	Het
Aak1	T	A	6: 86,955,190	I381N	probably benign	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adgrf2	A	G	17: 42,713,088	V164A	probably damaging	Het
Ahdc1	G	A	4: 133,065,986	A1513T	possibly damaging	Het
Akap13	T	C	7: 75,586,181	M168T	probably damaging	Het
Aox1	C	T	1: 58,056,215	T196I	probably benign	Het
Aqr	A	G	2: 114,118,669		probably benign	Het
Azi2	A	G	9: 118,047,440	D8G	possibly damaging	Het
Bcam	T	C	7: 19,764,193	T302A	probably benign	Het
Cct6b	A	T	11: 82,760,357	I110N	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Ceacam5	G	A	7: 17,759,338	S762N	possibly damaging	Het
Cecr2	T	C	6: 120,758,260	L819P	probably damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Chd2	A	G	7: 73,471,790		probably benign	Het
Col7a1	G	T	9: 108,964,440	G1357*	probably null	Het
Cux1	A	G	5: 136,565,543		probably benign	Het
Cwh43	A	T	5: 73,438,492	I535F	probably damaging	Het
Dexi	A	T	16: 10,542,689	M1K	probably null	Het
Dnah12	T	C	14: 26,812,790	V2081A	probably benign	Het
Efcab5	A	T	11: 77,116,182	L872Q	probably damaging	Het
Enpp7	A	G	11: 118,990,518	Y163C	probably damaging	Het
Fam221a	T	C	6: 49,372,614	Y38H	probably damaging	Het
Foxred1	A	G	9: 35,210,890	M1T	probably null	Het
Fscn3	C	T	6: 28,428,092	T26I	possibly damaging	Het
Galp	A	T	7: 6,213,837	D72V	probably damaging	Het
Gm9843	A	G	16: 76,403,531		noncoding transcript	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Lmbrd1	T	C	1: 24,692,995	Y98H	probably damaging	Het
Lrrc63	T	G	14: 75,107,336	Y437S	probably benign	Het
Macc1	A	G	12: 119,446,841	E448G	probably benign	Het
Madcam1	A	G	10: 79,668,360	H404R	probably benign	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Mroh3	T	C	1: 136,185,976	T692A	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Naip2	A	G	13: 100,161,902	F542S	probably damaging	Het
Napsa	A	G	7: 44,581,428	Y73C	probably damaging	Het
Ndst4	A	T	3: 125,561,505	H354L	possibly damaging	Het
Neil1	A	T	9: 57,146,970	V22E	probably damaging	Het
Nol4	T	C	18: 23,039,937	I36V	probably damaging	Het
Nprl3	G	A	11: 32,255,464	T111I	probably damaging	Het
Olfr1184	C	A	2: 88,487,443	T237N	probably damaging	Het
Olfr361	A	G	2: 37,085,505	M81T	possibly damaging	Het
Olfr385	A	T	11: 73,588,905	Y278N	probably damaging	Het
Pald1	G	A	10: 61,342,365	T624I	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,733	P388L	probably damaging	Het
Pcdhga6	T	C	18: 37,707,923	V232A	probably damaging	Het
Pde6b	A	G	5: 108,423,062	I388V	probably damaging	Het
Phactr2	C	A	10: 13,388,732		probably benign	Het
Prdx5	T	C	19: 6,908,109	D56G	probably damaging	Het
Ptprh	A	T	7: 4,571,970	I350N	probably damaging	Het
Rangap1	C	A	15: 81,710,460	E389D	probably benign	Het
Reln	A	G	5: 21,904,734	V3126A	probably damaging	Het
Rpl21	G	A	5: 146,835,037	G59S	possibly damaging	Het
Rsph6a	G	A	7: 19,057,550	V215M	probably damaging	Het
Smcp	T	C	3: 92,584,124	K139E	unknown	Het
Stag1	A	G	9: 100,889,618	T699A	probably benign	Het
Tarsl2	G	A	7: 65,688,952		probably null	Het
Tle1	G	T	4: 72,126,422	H459Q	possibly damaging	Het
Ttn	G	A	2: 76,731,019	P27302S	probably damaging	Het
Ttn	C	T	2: 76,741,266	V26428I	probably damaging	Het
Usp53	T	C	3: 122,949,319	E656G	probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vmn1r79	A	G	7: 12,176,212	N40S	possibly damaging	Het
Wdr35	A	G	12: 9,027,648	D1107G	possibly damaging	Het
Zfp101	A	G	17: 33,381,906	M292T	probably benign	Het
Zfp108	T	A	7: 24,261,845	C620*	probably null	Het
Zscan4b	T	C	7: 10,901,891	T170A	probably benign	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158600319	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158504313	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158580327	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158668631	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158511154	intron	probably benign
IGL02168:Astn1	APN	1	158609341	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158664130	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158510950	splice site	probably benign
IGL02307:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158502408	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158505395	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158688550	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158612395	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158668623	splice site	probably benign
IGL03354:Astn1	APN	1	158688604	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158597209	missense	probably benign	0.20
PIT4366001:Astn1	UTSW	1	158597211	missense	probably benign	0.23
R0024:Astn1	UTSW	1	158684215	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158579724	splice site	probably benign
R0099:Astn1	UTSW	1	158502151	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158688548	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158509891	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158600389	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158472389	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158509890	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158511109	nonsense	probably null
R1027:Astn1	UTSW	1	158580279	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158600365	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158502353	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158579576	splice site	probably benign
R1701:Astn1	UTSW	1	158504307	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158504251	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158601945	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158505316	intron	probably null
R1919:Astn1	UTSW	1	158509971	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158520521	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158609305	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158657120	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158600502	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158472408	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158667609	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158502150	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158657306	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158579666	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158612346	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158572951	critical splice acceptor site	probably null
R3745:Astn1	UTSW	1	158502060	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158579657	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158502032	intron	probably null
R4625:Astn1	UTSW	1	158580294	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158502251	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158612532	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158580363	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158600380	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158601937	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158509993	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158664121	nonsense	probably null
R6481:Astn1	UTSW	1	158612462	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158511148	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158612472	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158664074	nonsense	probably null
R7062:Astn1	UTSW	1	158688511	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158572987	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158664276	intron	probably null
R7402:Astn1	UTSW	1	158552855	intron	probably benign
R7412:Astn1	UTSW	1	158502349	missense	probably damaging	0.98
R7537:Astn1	UTSW	1	158505386	missense	possibly damaging	0.84
R7537:Astn1	UTSW	1	158667638	splice site	probably null
R7635:Astn1	UTSW	1	158667535	nonsense	probably null
Z1088:Astn1	UTSW	1	158472497	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158597206	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158684096	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCTGGAGACCTTAGTATCTAGTGAG -3'
(R):5'- TTCCATGCTTCTCCGGGATG -3'

Sequencing Primer
(F):5'- TCTAGTGAGAGAGACATGTCCTC -3'
(R):5'- ATGCCCTGCAACACTGG -3'

Posted On

2015-01-23