Incidental Mutation 'R3713:Olfr1184'
ID259715
Institutional Source Beutler Lab
Gene Symbol Olfr1184
Ensembl Gene ENSMUSG00000051424
Gene Nameolfactory receptor 1184
SynonymsGA_x6K02T2Q125-49974190-49975125, MOR225-3
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88483598-88489284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88487443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 237 (T237N)
Ref Sequence ENSEMBL: ENSMUSP00000149649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050038] [ENSMUST00000216675]
Predicted Effect probably damaging
Transcript: ENSMUST00000050038
AA Change: T237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058679
Gene: ENSMUSG00000051424
AA Change: T237N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216675
AA Change: T237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Olfr1184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Olfr1184 APN 2 88487248 missense probably damaging 1.00
IGL01288:Olfr1184 APN 2 88487248 missense probably damaging 1.00
IGL01790:Olfr1184 APN 2 88486926 missense possibly damaging 0.65
IGL02070:Olfr1184 APN 2 88487002 missense probably damaging 1.00
IGL02247:Olfr1184 APN 2 88487427 missense probably benign 0.00
IGL02932:Olfr1184 APN 2 88487175 missense probably benign 0.01
IGL02997:Olfr1184 APN 2 88487388 missense probably damaging 0.99
IGL03161:Olfr1184 APN 2 88487448 missense probably benign 0.01
PIT4531001:Olfr1184 UTSW 2 88487257 missense possibly damaging 0.95
R3715:Olfr1184 UTSW 2 88487443 missense probably damaging 1.00
R4421:Olfr1184 UTSW 2 88487241 missense probably damaging 1.00
R4514:Olfr1184 UTSW 2 88487365 missense probably benign 0.05
R5096:Olfr1184 UTSW 2 88487302 missense possibly damaging 0.89
R5661:Olfr1184 UTSW 2 88487097 missense probably damaging 0.98
R5851:Olfr1184 UTSW 2 88486860 missense possibly damaging 0.54
R6458:Olfr1184 UTSW 2 88487218 missense possibly damaging 0.90
R7073:Olfr1184 UTSW 2 88487307 missense probably benign 0.00
R7102:Olfr1184 UTSW 2 88487148 missense probably damaging 1.00
R7145:Olfr1184 UTSW 2 88487377 missense probably damaging 1.00
R7221:Olfr1184 UTSW 2 88487629 missense probably damaging 0.97
X0063:Olfr1184 UTSW 2 88487490 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCCTTTGCTGAAAGTTGCC -3'
(R):5'- TAGTCACCATTGCATCACCC -3'

Sequencing Primer
(F):5'- TGAAAGTTGCCTGTACCGAC -3'
(R):5'- CTCTTCTGAAAACATGTTTTGACACC -3'
Posted On2015-01-23