Incidental Mutation 'R0329:Gbf1'
ID25972
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission 038538-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0329 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 46272270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
Predicted Effect probably null
Transcript: ENSMUST00000026254
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176853
Predicted Effect probably null
Transcript: ENSMUST00000176992
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177406
Predicted Effect probably benign
Transcript: ENSMUST00000177512
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 99% (107/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
4931409K22Rik T C 5: 24,545,785 probably null Het
Abca13 A T 11: 9,399,430 H3668L probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adam28 T C 14: 68,617,739 K651R probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Atp8a1 T A 5: 67,812,073 probably benign Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Casp12 T A 9: 5,345,534 probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cdhr2 T A 13: 54,734,801 probably benign Het
Cftr T A 6: 18,226,097 M318K probably null Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cnnm1 C T 19: 43,441,910 P489L probably damaging Het
Cntnap1 A T 11: 101,188,309 D1175V probably damaging Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Crcp C A 5: 130,042,242 Q61K possibly damaging Het
Dcaf8 T A 1: 172,187,411 D414E probably benign Het
Ddx28 T C 8: 106,010,245 T394A probably benign Het
Ddx55 T C 5: 124,559,147 F191L probably benign Het
Dnaaf1 T C 8: 119,596,017 probably benign Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elf5 A G 2: 103,430,420 probably benign Het
Emcn T A 3: 137,416,814 probably benign Het
Erbb4 T C 1: 68,298,280 probably benign Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Etfdh T C 3: 79,609,844 I353V probably benign Het
Fam172a T A 13: 77,761,951 probably benign Het
Fbxl12 C T 9: 20,638,480 G316D probably damaging Het
Gbp2b T G 3: 142,608,176 S406A probably benign Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gp1ba A G 11: 70,640,409 probably benign Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Hectd4 T C 5: 121,259,864 I285T probably benign Het
Hrh4 A G 18: 13,007,245 probably benign Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Hspa13 A T 16: 75,765,130 D60E probably damaging Het
Htt T A 5: 34,817,134 probably benign Het
Ispd C T 12: 36,381,838 A22V possibly damaging Het
Kif14 G C 1: 136,496,026 probably benign Het
Kit T G 5: 75,652,829 V888G probably damaging Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrriq4 T C 3: 30,655,724 S406P probably benign Het
Man2c1 T C 9: 57,141,183 V777A probably benign Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myo9a C G 9: 59,923,677 T2368S probably damaging Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Npm3 A G 19: 45,749,526 F11L probably benign Het
Nutf2 T A 8: 105,876,363 S37T probably damaging Het
Obscn T A 11: 59,040,441 I5790F probably damaging Het
Obscn A T 11: 59,052,506 D4833E probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr39 T A 9: 20,285,857 S61T possibly damaging Het
Olfr955 T C 9: 39,470,556 T57A possibly damaging Het
Pcdhb1 A G 18: 37,267,024 D676G possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Pdk1 T C 2: 71,895,674 probably benign Het
Phxr2 T C 10: 99,126,117 probably benign Het
Pidd1 A T 7: 141,439,561 probably benign Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Pot1a A G 6: 25,778,831 probably benign Het
Prdm5 T C 6: 65,862,903 probably benign Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pyroxd1 A G 6: 142,361,976 I491V probably benign Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Slc9b1 C T 3: 135,373,235 R218* probably null Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stat4 A G 1: 52,090,870 probably benign Het
Steap4 T C 5: 7,975,829 V130A possibly damaging Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tgm4 T C 9: 123,048,557 probably null Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Tmem145 A G 7: 25,308,674 probably benign Het
Tsacc A G 3: 88,282,862 S94P possibly damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Ugt2b35 A G 5: 87,003,405 K290R probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Usp10 T A 8: 119,936,557 C39* probably null Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r7 C A 3: 64,691,018 C797F probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Wdr27 A G 17: 14,934,459 probably benign Het
Ythdc2 A G 18: 44,865,060 probably benign Het
Zcwpw2 C A 9: 118,014,055 noncoding transcript Het
Zdhhc1 C A 8: 105,483,543 A81S probably benign Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTCCCCTCTAGCAATGTGACC -3'
(R):5'- AGGACAGTCTCAACTGGAGAAGCC -3'

Sequencing Primer
(F):5'- TGATCACAGAAAGCAAGTTCCTC -3'
(R):5'- CACTGAGGCAGCAGTCTG -3'
Posted On2013-04-16