Incidental Mutation 'R3713:Aak1'
ID259729
Institutional Source Beutler Lab
Gene Symbol Aak1
Ensembl Gene ENSMUSG00000057230
Gene NameAP2 associated kinase 1
Synonyms5530400K14Rik, D6Ertd245e
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86849517-87003223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86955190 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 381 (I381N)
Ref Sequence ENSEMBL: ENSMUSP00000086948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003710] [ENSMUST00000089519]
Predicted Effect probably benign
Transcript: ENSMUST00000003710
AA Change: I381N

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003710
Gene: ENSMUSG00000057230
AA Change: I381N

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1.5e-27 PFAM
Pfam:Pkinase 46 312 7e-43 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 527 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 712 730 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089519
AA Change: I381N

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086948
Gene: ENSMUSG00000057230
AA Change: I381N

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1e-26 PFAM
Pfam:Pkinase 46 312 2.2e-44 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 510 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 608 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 716 728 N/A INTRINSIC
low complexity region 793 811 N/A INTRINSIC
low complexity region 929 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113668
SMART Domains Protein: ENSMUSP00000109298
Gene: ENSMUSG00000057230

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 3.5e-28 PFAM
Pfam:Pkinase 46 312 1.7e-43 PFAM
Pfam:Kinase-like 126 301 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204613
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Aak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Aak1 APN 6 86946153 missense probably damaging 1.00
IGL01284:Aak1 APN 6 86850053 start codon destroyed possibly damaging 0.86
IGL01292:Aak1 APN 6 86949538 splice site probably benign
IGL01344:Aak1 APN 6 86946157 missense possibly damaging 0.49
IGL02317:Aak1 APN 6 86956300 missense possibly damaging 0.61
IGL02422:Aak1 APN 6 86982616 missense unknown
IGL02531:Aak1 APN 6 86956447 missense unknown
IGL02719:Aak1 APN 6 86959170 intron probably benign
IGL03051:Aak1 APN 6 86987301 utr 3 prime probably benign
R0382:Aak1 UTSW 6 86946919 missense probably benign 0.19
R0846:Aak1 UTSW 6 86959089 intron probably benign
R1074:Aak1 UTSW 6 86935439 missense probably damaging 0.97
R1141:Aak1 UTSW 6 86965476 critical splice acceptor site probably null
R1221:Aak1 UTSW 6 86965478 missense unknown
R1261:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1262:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1470:Aak1 UTSW 6 86967355 missense unknown
R1470:Aak1 UTSW 6 86967355 missense unknown
R1931:Aak1 UTSW 6 86956336 missense unknown
R3785:Aak1 UTSW 6 86965578 missense unknown
R3815:Aak1 UTSW 6 86959042 intron probably benign
R3816:Aak1 UTSW 6 86959042 intron probably benign
R3819:Aak1 UTSW 6 86959042 intron probably benign
R4165:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4166:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4351:Aak1 UTSW 6 86935537 splice site probably null
R4430:Aak1 UTSW 6 86986366 missense unknown
R4431:Aak1 UTSW 6 86986318 missense unknown
R4665:Aak1 UTSW 6 86925077 missense probably null 1.00
R4821:Aak1 UTSW 6 86850189 missense probably damaging 1.00
R5088:Aak1 UTSW 6 86944480 critical splice donor site probably null
R5543:Aak1 UTSW 6 86982645 critical splice donor site probably null
R5567:Aak1 UTSW 6 86955168 nonsense probably null
R5726:Aak1 UTSW 6 86925124 nonsense probably null
R6083:Aak1 UTSW 6 86963996 missense unknown
R6269:Aak1 UTSW 6 86964051 missense unknown
R6693:Aak1 UTSW 6 86965515 missense unknown
R6700:Aak1 UTSW 6 86964203 missense unknown
R6759:Aak1 UTSW 6 86944417 missense probably damaging 1.00
R6969:Aak1 UTSW 6 86981335 missense unknown
Y4335:Aak1 UTSW 6 86959142 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCGTGTTAAGGGCAGACATC -3'
(R):5'- CAGAGGTCTTAGTGATCCACC -3'

Sequencing Primer
(F):5'- AAGGGCAGACATCTTGTGTTC -3'
(R):5'- GTCTTAGTGATCCACCCGAGTACAG -3'
Posted On2015-01-23