Mutagenetix > Incidental Mutations

Incidental Mutation 'R3713:Ptprh'

259732

Institutional Source

Beutler Lab

Gene Symbol

Ptprh

Ensembl Gene

ENSMUSG00000035429

Gene Name

protein tyrosine phosphatase, receptor type, H

Synonyms

SAP-1

MMRRC Submission

040706-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4548612-4604041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4571970 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 350 (I350N)

Ref Sequence

ENSEMBL: ENSMUSP00000145543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049113
AA Change: I350N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: I350N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166650
AA Change: I350N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: I350N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000206999
AA Change: I350N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6775

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	T	C	16: 88,627,193	M137V	probably benign	Het
Aak1	T	A	6: 86,955,190	I381N	probably benign	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adgrf2	A	G	17: 42,713,088	V164A	probably damaging	Het
Ahdc1	G	A	4: 133,065,986	A1513T	possibly damaging	Het
Akap13	T	C	7: 75,586,181	M168T	probably damaging	Het
Aox1	C	T	1: 58,056,215	T196I	probably benign	Het
Aqr	A	G	2: 114,118,669		probably benign	Het
Astn1	A	G	1: 158,667,532	E1042G	possibly damaging	Het
Azi2	A	G	9: 118,047,440	D8G	possibly damaging	Het
Bcam	T	C	7: 19,764,193	T302A	probably benign	Het
Cct6b	A	T	11: 82,760,357	I110N	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Ceacam5	G	A	7: 17,759,338	S762N	possibly damaging	Het
Cecr2	T	C	6: 120,758,260	L819P	probably damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Chd2	A	G	7: 73,471,790		probably benign	Het
Col7a1	G	T	9: 108,964,440	G1357*	probably null	Het
Cux1	A	G	5: 136,565,543		probably benign	Het
Cwh43	A	T	5: 73,438,492	I535F	probably damaging	Het
Dexi	A	T	16: 10,542,689	M1K	probably null	Het
Dnah12	T	C	14: 26,812,790	V2081A	probably benign	Het
Efcab5	A	T	11: 77,116,182	L872Q	probably damaging	Het
Enpp7	A	G	11: 118,990,518	Y163C	probably damaging	Het
Fam221a	T	C	6: 49,372,614	Y38H	probably damaging	Het
Foxred1	A	G	9: 35,210,890	M1T	probably null	Het
Fscn3	C	T	6: 28,428,092	T26I	possibly damaging	Het
Galp	A	T	7: 6,213,837	D72V	probably damaging	Het
Gm9843	A	G	16: 76,403,531		noncoding transcript	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Lmbrd1	T	C	1: 24,692,995	Y98H	probably damaging	Het
Lrrc63	T	G	14: 75,107,336	Y437S	probably benign	Het
Macc1	A	G	12: 119,446,841	E448G	probably benign	Het
Madcam1	A	G	10: 79,668,360	H404R	probably benign	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Mroh3	T	C	1: 136,185,976	T692A	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Naip2	A	G	13: 100,161,902	F542S	probably damaging	Het
Napsa	A	G	7: 44,581,428	Y73C	probably damaging	Het
Ndst4	A	T	3: 125,561,505	H354L	possibly damaging	Het
Neil1	A	T	9: 57,146,970	V22E	probably damaging	Het
Nol4	T	C	18: 23,039,937	I36V	probably damaging	Het
Nprl3	G	A	11: 32,255,464	T111I	probably damaging	Het
Olfr1184	C	A	2: 88,487,443	T237N	probably damaging	Het
Olfr361	A	G	2: 37,085,505	M81T	possibly damaging	Het
Olfr385	A	T	11: 73,588,905	Y278N	probably damaging	Het
Pald1	G	A	10: 61,342,365	T624I	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,733	P388L	probably damaging	Het
Pcdhga6	T	C	18: 37,707,923	V232A	probably damaging	Het
Pde6b	A	G	5: 108,423,062	I388V	probably damaging	Het
Phactr2	C	A	10: 13,388,732		probably benign	Het
Prdx5	T	C	19: 6,908,109	D56G	probably damaging	Het
Rangap1	C	A	15: 81,710,460	E389D	probably benign	Het
Reln	A	G	5: 21,904,734	V3126A	probably damaging	Het
Rpl21	G	A	5: 146,835,037	G59S	possibly damaging	Het
Rsph6a	G	A	7: 19,057,550	V215M	probably damaging	Het
Smcp	T	C	3: 92,584,124	K139E	unknown	Het
Stag1	A	G	9: 100,889,618	T699A	probably benign	Het
Tarsl2	G	A	7: 65,688,952		probably null	Het
Tle1	G	T	4: 72,126,422	H459Q	possibly damaging	Het
Ttn	G	A	2: 76,731,019	P27302S	probably damaging	Het
Ttn	C	T	2: 76,741,266	V26428I	probably damaging	Het
Usp53	T	C	3: 122,949,319	E656G	probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vmn1r79	A	G	7: 12,176,212	N40S	possibly damaging	Het
Wdr35	A	G	12: 9,027,648	D1107G	possibly damaging	Het
Zfp101	A	G	17: 33,381,906	M292T	probably benign	Het
Zfp108	T	A	7: 24,261,845	C620*	probably null	Het
Zscan4b	T	C	7: 10,901,891	T170A	probably benign	Het

Other mutations in Ptprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Ptprh	APN	7	4580916	missense	probably benign	0.23
IGL02420:Ptprh	APN	7	4580930	missense	probably damaging	1.00
IGL02619:Ptprh	APN	7	4549499	missense	probably damaging	1.00
IGL02729:Ptprh	APN	7	4580874	missense	probably damaging	0.99
BB008:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
BB018:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
R0018:Ptprh	UTSW	7	4601846	critical splice donor site	probably null
R0049:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R0449:Ptprh	UTSW	7	4598006	missense	probably damaging	1.00
R0477:Ptprh	UTSW	7	4597998	missense	possibly damaging	0.87
R0626:Ptprh	UTSW	7	4564272	missense	probably benign	0.00
R0741:Ptprh	UTSW	7	4554173	critical splice donor site	probably null
R1068:Ptprh	UTSW	7	4549463	missense	possibly damaging	0.89
R1226:Ptprh	UTSW	7	4603092	nonsense	probably null
R1487:Ptprh	UTSW	7	4552738	missense	probably damaging	1.00
R1495:Ptprh	UTSW	7	4580889	missense	probably benign	0.02
R1537:Ptprh	UTSW	7	4549699	missense	probably damaging	1.00
R1601:Ptprh	UTSW	7	4552638	missense	probably damaging	1.00
R1731:Ptprh	UTSW	7	4601913	missense	probably benign	0.00
R1920:Ptprh	UTSW	7	4549395	missense	probably benign	0.25
R2082:Ptprh	UTSW	7	4550775	missense	probably damaging	1.00
R2180:Ptprh	UTSW	7	4601868	missense	probably benign	0.26
R2214:Ptprh	UTSW	7	4552922	missense	possibly damaging	0.78
R2245:Ptprh	UTSW	7	4573346	missense	probably benign	0.09
R2271:Ptprh	UTSW	7	4603133	start gained	probably benign
R3693:Ptprh	UTSW	7	4554235	missense	probably damaging	0.99
R4081:Ptprh	UTSW	7	4580988	missense	probably damaging	0.99
R4205:Ptprh	UTSW	7	4597992	missense	probably damaging	1.00
R4689:Ptprh	UTSW	7	4597997	missense	possibly damaging	0.74
R4782:Ptprh	UTSW	7	4569577	missense	probably benign	0.08
R4838:Ptprh	UTSW	7	4573430	missense	possibly damaging	0.78
R4974:Ptprh	UTSW	7	4551007	splice site	probably null
R5218:Ptprh	UTSW	7	4597920	missense	probably benign	0.05
R5430:Ptprh	UTSW	7	4551047	missense	probably damaging	1.00
R5533:Ptprh	UTSW	7	4549505	missense	probably damaging	1.00
R5544:Ptprh	UTSW	7	4580910	nonsense	probably null
R5547:Ptprh	UTSW	7	4554222	nonsense	probably null
R5869:Ptprh	UTSW	7	4601940	missense	probably benign	0.00
R5928:Ptprh	UTSW	7	4573508	missense	probably damaging	1.00
R6063:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R6112:Ptprh	UTSW	7	4597923	missense	probably benign	0.01
R6493:Ptprh	UTSW	7	4580990	missense	possibly damaging	0.65
R6733:Ptprh	UTSW	7	4603044	splice site	probably null
R6836:Ptprh	UTSW	7	4551135	missense	probably damaging	1.00
R6859:Ptprh	UTSW	7	4549371	nonsense	probably null
R6868:Ptprh	UTSW	7	4601865	missense	probably benign
R7015:Ptprh	UTSW	7	4552627	critical splice donor site	probably null
R7092:Ptprh	UTSW	7	4580861	critical splice donor site	probably null
R7147:Ptprh	UTSW	7	4550782	missense	probably damaging	1.00
R7177:Ptprh	UTSW	7	4569481	missense	possibly damaging	0.77
R7358:Ptprh	UTSW	7	4551007	splice site	probably null
R7436:Ptprh	UTSW	7	4552743	missense	probably damaging	1.00
R7512:Ptprh	UTSW	7	4571781	missense	possibly damaging	0.60
R7863:Ptprh	UTSW	7	4603098	start codon destroyed	probably benign	0.31
R7931:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
R7973:Ptprh	UTSW	7	4580888	missense	possibly damaging	0.55
R8239:Ptprh	UTSW	7	4581091	missense	probably damaging	1.00
R8331:Ptprh	UTSW	7	4549481	missense	probably damaging	1.00
RF022:Ptprh	UTSW	7	4549368	missense	probably benign
Z1177:Ptprh	UTSW	7	4597971	missense	probably damaging	0.99
Z1177:Ptprh	UTSW	7	4598118	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATAGTGTCTGCTCTCACCTGTG -3'
(R):5'- GGGAAACTGTGCTTCCATGTTG -3'

Sequencing Primer
(F):5'- AGAGTCTCATTGGTGCTATAGACTCC -3'
(R):5'- GGACTTCCACCTCTGCCACTG -3'

Posted On

2015-01-23