Incidental Mutation 'R3713:Bcam'
List |< first << previous [record 11 of 71] next >> last >|
ID259738
Institutional Source Beutler Lab
Gene Symbol Bcam
Ensembl Gene ENSMUSG00000002980
Gene Namebasal cell adhesion molecule
Synonyms1200005K12Rik, Lu, B-CAM
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19756131-19771016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19764193 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 302 (T302A)
Ref Sequence ENSEMBL: ENSMUSP00000003061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003061] [ENSMUST00000133427] [ENSMUST00000155244]
Predicted Effect probably benign
Transcript: ENSMUST00000003061
AA Change: T302A

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 137 3.1e-9 SMART
IG_like 174 254 1.89e1 SMART
IGc2 275 337 2.58e-6 SMART
IGc2 369 425 2.16e-8 SMART
IG_like 458 523 7.29e-2 SMART
transmembrane domain 541 563 N/A INTRINSIC
low complexity region 601 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133271
Predicted Effect probably benign
Transcript: ENSMUST00000133427
Predicted Effect probably benign
Transcript: ENSMUST00000155244
SMART Domains Protein: ENSMUSP00000121145
Gene: ENSMUSG00000002980

DomainStartEndE-ValueType
IG 32 137 3.1e-9 SMART
Pfam:C2-set_2 143 193 4.3e-12 PFAM
Pfam:Ig_2 145 192 1e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208280
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Bcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcam APN 7 19756799 missense probably benign 0.02
IGL01433:Bcam APN 7 19760182 missense possibly damaging 0.75
IGL01712:Bcam APN 7 19758767 missense probably damaging 0.99
IGL01943:Bcam APN 7 19765498 missense probably damaging 1.00
IGL01946:Bcam APN 7 19760117 nonsense probably null
IGL02281:Bcam APN 7 19758691 missense probably damaging 1.00
IGL02714:Bcam APN 7 19758807 splice site probably benign
IGL02837:Bcam UTSW 7 19764186 missense probably damaging 1.00
PIT4514001:Bcam UTSW 7 19764066 missense probably benign 0.06
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R1500:Bcam UTSW 7 19758964 missense possibly damaging 0.75
R1575:Bcam UTSW 7 19760382 missense possibly damaging 0.87
R1585:Bcam UTSW 7 19760186 missense probably damaging 1.00
R1768:Bcam UTSW 7 19765618 missense probably null 1.00
R1813:Bcam UTSW 7 19766715 missense probably damaging 1.00
R1896:Bcam UTSW 7 19766715 missense probably damaging 1.00
R2016:Bcam UTSW 7 19760349 missense probably benign 0.38
R2117:Bcam UTSW 7 19758427 missense possibly damaging 0.71
R3917:Bcam UTSW 7 19765450 missense probably damaging 1.00
R4596:Bcam UTSW 7 19764157 missense probably damaging 0.97
R4866:Bcam UTSW 7 19765472 missense probably benign 0.00
R4874:Bcam UTSW 7 19769322 intron probably benign
R5054:Bcam UTSW 7 19756860 intron probably benign
R5062:Bcam UTSW 7 19760101 missense possibly damaging 0.62
R6783:Bcam UTSW 7 19766881 missense probably damaging 1.00
R6853:Bcam UTSW 7 19760406 missense probably damaging 1.00
R7016:Bcam UTSW 7 19758443 nonsense probably null
R7174:Bcam UTSW 7 19765451 missense probably damaging 1.00
R7237:Bcam UTSW 7 19769307 intron probably null
R7733:Bcam UTSW 7 19760388 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTGGAAAATCTGTGAGGCAG -3'
(R):5'- GGTGAGGACTTTTGACCCTG -3'

Sequencing Primer
(F):5'- AGCGGATGGAACCTGACC -3'
(R):5'- ACTTTTGACCCTGACTTGAGATG -3'
Posted On2015-01-23