Incidental Mutation 'R3713:Zfp108'
ID259739
Institutional Source Beutler Lab
Gene Symbol Zfp108
Ensembl Gene ENSMUSG00000030486
Gene Namezinc finger protein 108
Synonyms
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24254794-24262445 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 24261845 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 620 (C620*)
Ref Sequence ENSEMBL: ENSMUSP00000145928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072713] [ENSMUST00000205982] [ENSMUST00000206777]
Predicted Effect probably null
Transcript: ENSMUST00000072713
AA Change: C620*
SMART Domains Protein: ENSMUSP00000072496
Gene: ENSMUSG00000030486
AA Change: C620*

DomainStartEndE-ValueType
KRAB 8 63 7.94e-18 SMART
low complexity region 140 153 N/A INTRINSIC
ZnF_C2H2 281 303 1.33e-1 SMART
ZnF_C2H2 309 331 1.69e-3 SMART
ZnF_C2H2 337 359 1.3e-4 SMART
ZnF_C2H2 365 387 2.71e-2 SMART
ZnF_C2H2 393 415 5.14e-3 SMART
ZnF_C2H2 421 443 1.87e-5 SMART
ZnF_C2H2 449 471 3.44e-4 SMART
ZnF_C2H2 477 497 1.08e1 SMART
ZnF_C2H2 503 525 3.89e-3 SMART
ZnF_C2H2 531 553 2.09e-3 SMART
ZnF_C2H2 559 581 4.61e-5 SMART
ZnF_C2H2 587 609 7.9e-4 SMART
ZnF_C2H2 615 637 1.67e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205982
AA Change: C620*
Predicted Effect probably null
Transcript: ENSMUST00000206777
AA Change: C620*
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Zfp108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Zfp108 APN 7 24261486 missense possibly damaging 0.82
IGL01392:Zfp108 APN 7 24258447 splice site probably benign
R0123:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0126:Zfp108 UTSW 7 24260724 missense probably benign 0.01
R0134:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0243:Zfp108 UTSW 7 24261783 missense possibly damaging 0.81
R1227:Zfp108 UTSW 7 24260460 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1731:Zfp108 UTSW 7 24258539 missense possibly damaging 0.75
R1739:Zfp108 UTSW 7 24261310 missense probably damaging 1.00
R1751:Zfp108 UTSW 7 24261896 missense probably damaging 1.00
R3839:Zfp108 UTSW 7 24260556 missense probably benign 0.01
R3919:Zfp108 UTSW 7 24260832 missense probably damaging 0.99
R3922:Zfp108 UTSW 7 24261348 missense probably damaging 1.00
R4707:Zfp108 UTSW 7 24260412 missense probably benign 0.08
R4912:Zfp108 UTSW 7 24261314 missense probably damaging 1.00
R4965:Zfp108 UTSW 7 24260148 missense probably benign
R4989:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5014:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5163:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5183:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5184:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5185:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5453:Zfp108 UTSW 7 24261264 missense probably damaging 1.00
R5600:Zfp108 UTSW 7 24260586 missense probably benign 0.00
R6494:Zfp108 UTSW 7 24261357 missense probably damaging 1.00
R6601:Zfp108 UTSW 7 24261394 missense probably damaging 0.98
R6735:Zfp108 UTSW 7 24261772 missense probably damaging 1.00
R7646:Zfp108 UTSW 7 24261415 missense probably damaging 1.00
R7732:Zfp108 UTSW 7 24261527
Predicted Primers PCR Primer
(F):5'- GTTCCGTCAGGCCTCAATCC -3'
(R):5'- GAGTCCACCTGAGTGCAGAAC -3'

Sequencing Primer
(F):5'- CCCTACAAATGTGACACGTGTGG -3'
(R):5'- CCTGAGTGCAGAACAAACCTAGG -3'
Posted On2015-01-23