Incidental Mutation 'R3713:Akap13'
ID 259745
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase anchor protein 13
Synonyms PROTO-LB, Ht31, 5830460E08Rik, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, AKAP-Lbc
MMRRC Submission 040706-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3713 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 75105282-75404357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75235929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 168 (M168T)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136989
AA Change: C236R
Predicted Effect possibly damaging
Transcript: ENSMUST00000147005
AA Change: M168T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: M168T

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166315
AA Change: M168T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: M168T

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207750
AA Change: M168T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208187
Meta Mutation Damage Score 0.1938 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,424,081 (GRCm39) M137V probably benign Het
Aak1 T A 6: 86,932,172 (GRCm39) I381N probably benign Het
Abcd4 C T 12: 84,658,533 (GRCm39) M223I probably benign Het
Adgrf2 A G 17: 43,023,979 (GRCm39) V164A probably damaging Het
Ahdc1 G A 4: 132,793,297 (GRCm39) A1513T possibly damaging Het
Aox1 C T 1: 58,095,374 (GRCm39) T196I probably benign Het
Aqr A G 2: 113,949,150 (GRCm39) probably benign Het
Astn1 A G 1: 158,495,102 (GRCm39) E1042G possibly damaging Het
Azi2 A G 9: 117,876,508 (GRCm39) D8G possibly damaging Het
Bcam T C 7: 19,498,118 (GRCm39) T302A probably benign Het
Cct6b A T 11: 82,651,183 (GRCm39) I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Ceacam5 G A 7: 17,493,263 (GRCm39) S762N possibly damaging Het
Cecr2 T C 6: 120,735,221 (GRCm39) L819P probably damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Chd2 A G 7: 73,121,538 (GRCm39) probably benign Het
Col7a1 G T 9: 108,793,508 (GRCm39) G1357* probably null Het
Cux1 A G 5: 136,594,397 (GRCm39) probably benign Het
Cwh43 A T 5: 73,595,835 (GRCm39) I535F probably damaging Het
Dexi A T 16: 10,360,553 (GRCm39) M1K probably null Het
Dnah12 T C 14: 26,534,747 (GRCm39) V2081A probably benign Het
Efcab5 A T 11: 77,007,008 (GRCm39) L872Q probably damaging Het
Enpp7 A G 11: 118,881,344 (GRCm39) Y163C probably damaging Het
Fam221a T C 6: 49,349,548 (GRCm39) Y38H probably damaging Het
Foxred1 A G 9: 35,122,186 (GRCm39) M1T probably null Het
Fscn3 C T 6: 28,428,091 (GRCm39) T26I possibly damaging Het
Galp A T 7: 6,216,836 (GRCm39) D72V probably damaging Het
Gm9843 A G 16: 76,200,419 (GRCm39) noncoding transcript Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Lmbrd1 T C 1: 24,732,076 (GRCm39) Y98H probably damaging Het
Lrrc63 T G 14: 75,344,776 (GRCm39) Y437S probably benign Het
Macc1 A G 12: 119,410,576 (GRCm39) E448G probably benign Het
Madcam1 A G 10: 79,504,194 (GRCm39) H404R probably benign Het
Mink1 G T 11: 70,499,776 (GRCm39) R773L possibly damaging Het
Mroh2b A G 15: 4,973,131 (GRCm39) I1045V probably benign Het
Mroh3 T C 1: 136,113,714 (GRCm39) T692A probably benign Het
Myo15a A T 11: 60,370,057 (GRCm39) E939V possibly damaging Het
Naip2 A G 13: 100,298,410 (GRCm39) F542S probably damaging Het
Napsa A G 7: 44,230,852 (GRCm39) Y73C probably damaging Het
Ndst4 A T 3: 125,355,154 (GRCm39) H354L possibly damaging Het
Neil1 A T 9: 57,054,254 (GRCm39) V22E probably damaging Het
Nol4 T C 18: 23,172,994 (GRCm39) I36V probably damaging Het
Nprl3 G A 11: 32,205,464 (GRCm39) T111I probably damaging Het
Or12k8 A G 2: 36,975,517 (GRCm39) M81T possibly damaging Het
Or1e26 A T 11: 73,479,731 (GRCm39) Y278N probably damaging Het
Or4p22 C A 2: 88,317,787 (GRCm39) T237N probably damaging Het
Pald1 G A 10: 61,178,144 (GRCm39) T624I possibly damaging Het
Pcdhb13 C T 18: 37,576,786 (GRCm39) P388L probably damaging Het
Pcdhga6 T C 18: 37,840,976 (GRCm39) V232A probably damaging Het
Pde6b A G 5: 108,570,928 (GRCm39) I388V probably damaging Het
Phactr2 C A 10: 13,264,476 (GRCm39) probably benign Het
Prdx5 T C 19: 6,885,477 (GRCm39) D56G probably damaging Het
Ptprh A T 7: 4,574,969 (GRCm39) I350N probably damaging Het
Rangap1 C A 15: 81,594,661 (GRCm39) E389D probably benign Het
Reln A G 5: 22,109,732 (GRCm39) V3126A probably damaging Het
Rpl21 G A 5: 146,771,847 (GRCm39) G59S possibly damaging Het
Rsph6a G A 7: 18,791,475 (GRCm39) V215M probably damaging Het
Smcp T C 3: 92,491,431 (GRCm39) K139E unknown Het
Stag1 A G 9: 100,771,671 (GRCm39) T699A probably benign Het
Tars3 G A 7: 65,338,700 (GRCm39) probably null Het
Tle1 G T 4: 72,044,659 (GRCm39) H459Q possibly damaging Het
Ttn G A 2: 76,561,363 (GRCm39) P27302S probably damaging Het
Ttn C T 2: 76,571,610 (GRCm39) V26428I probably damaging Het
Usp53 T C 3: 122,742,968 (GRCm39) E656G probably benign Het
Vmn1r218 A T 13: 23,321,081 (GRCm39) N63Y probably damaging Het
Vmn1r79 A G 7: 11,910,139 (GRCm39) N40S possibly damaging Het
Wdr35 A G 12: 9,077,648 (GRCm39) D1107G possibly damaging Het
Zfp101 A G 17: 33,600,880 (GRCm39) M292T probably benign Het
Zfp108 T A 7: 23,961,270 (GRCm39) C620* probably null Het
Zscan4b T C 7: 10,635,818 (GRCm39) T170A probably benign Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,375,719 (GRCm39) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,378,667 (GRCm39) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,373,643 (GRCm39) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,260,417 (GRCm39) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,354,146 (GRCm39) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,354,260 (GRCm39) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,259,475 (GRCm39) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,327,195 (GRCm39) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,400,381 (GRCm39) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,316,279 (GRCm39) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,219,684 (GRCm39) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,375,096 (GRCm39) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,252,595 (GRCm39) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,397,594 (GRCm39) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,258,270 (GRCm39) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,397,353 (GRCm39) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,369,928 (GRCm39) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,347,141 (GRCm39) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,219,767 (GRCm39) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,396,515 (GRCm39) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,316,293 (GRCm39) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,252,659 (GRCm39) missense probably benign
IGL02421:Akap13 APN 7 75,367,554 (GRCm39) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,258,936 (GRCm39) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,258,405 (GRCm39) missense probably benign
IGL03051:Akap13 APN 7 75,260,233 (GRCm39) nonsense probably null
IGL03160:Akap13 APN 7 75,380,165 (GRCm39) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,259,500 (GRCm39) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,386,352 (GRCm39) splice site probably benign
R0310:Akap13 UTSW 7 75,264,678 (GRCm39) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,380,248 (GRCm39) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,259,677 (GRCm39) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,396,544 (GRCm39) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,264,744 (GRCm39) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,397,494 (GRCm39) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,375,128 (GRCm39) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,337,034 (GRCm39) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,327,157 (GRCm39) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,235,941 (GRCm39) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,385,526 (GRCm39) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,326,942 (GRCm39) missense probably damaging 1.00
R1773:Akap13 UTSW 7 75,333,199 (GRCm39) missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1786:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,260,783 (GRCm39) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,258,453 (GRCm39) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,260,475 (GRCm39) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,354,264 (GRCm39) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,354,279 (GRCm39) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,260,318 (GRCm39) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,375,052 (GRCm39) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,389,225 (GRCm39) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,316,298 (GRCm39) missense probably damaging 1.00
R3731:Akap13 UTSW 7 75,261,125 (GRCm39) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,258,585 (GRCm39) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,351,901 (GRCm39) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,259,889 (GRCm39) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,219,699 (GRCm39) nonsense probably null
R4205:Akap13 UTSW 7 75,260,667 (GRCm39) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,258,732 (GRCm39) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,252,521 (GRCm39) splice site probably null
R4632:Akap13 UTSW 7 75,316,301 (GRCm39) missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4669:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,229,312 (GRCm39) nonsense probably null
R4821:Akap13 UTSW 7 75,327,255 (GRCm39) intron probably benign
R4868:Akap13 UTSW 7 75,393,252 (GRCm39) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,375,068 (GRCm39) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,398,988 (GRCm39) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,399,178 (GRCm39) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,380,276 (GRCm39) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,337,000 (GRCm39) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,259,362 (GRCm39) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,259,991 (GRCm39) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,252,652 (GRCm39) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,252,578 (GRCm39) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,236,049 (GRCm39) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,354,120 (GRCm39) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,351,902 (GRCm39) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,378,894 (GRCm39) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,259,932 (GRCm39) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,259,656 (GRCm39) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,327,164 (GRCm39) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,236,028 (GRCm39) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,398,941 (GRCm39) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,335,002 (GRCm39) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,376,792 (GRCm39) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,229,516 (GRCm39) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,380,111 (GRCm39) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,219,729 (GRCm39) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,252,646 (GRCm39) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,389,206 (GRCm39) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,260,010 (GRCm39) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,369,943 (GRCm39) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,229,342 (GRCm39) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,380,327 (GRCm39) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,398,995 (GRCm39) missense probably benign
R7636:Akap13 UTSW 7 75,259,621 (GRCm39) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,293,202 (GRCm39) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,219,648 (GRCm39) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,378,544 (GRCm39) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,327,006 (GRCm39) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,260,076 (GRCm39) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,392,390 (GRCm39) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,235,964 (GRCm39) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,261,218 (GRCm39) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,229,444 (GRCm39) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,260,340 (GRCm39) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,351,979 (GRCm39) splice site probably null
R8174:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,397,552 (GRCm39) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8465:Akap13 UTSW 7 75,376,786 (GRCm39) missense probably benign 0.11
R8512:Akap13 UTSW 7 75,260,834 (GRCm39) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,375,076 (GRCm39) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,260,456 (GRCm39) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,260,444 (GRCm39) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,259,606 (GRCm39) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,258,752 (GRCm39) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,184,601 (GRCm39) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,378,882 (GRCm39) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,259,074 (GRCm39) missense probably benign
R9152:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,259,229 (GRCm39) missense probably benign 0.00
R9160:Akap13 UTSW 7 75,385,526 (GRCm39) missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75,354,249 (GRCm39) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,258,836 (GRCm39) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,293,193 (GRCm39) missense
R9564:Akap13 UTSW 7 75,259,161 (GRCm39) missense probably benign
R9621:Akap13 UTSW 7 75,386,090 (GRCm39) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,236,084 (GRCm39) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,380,300 (GRCm39) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,264,753 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTGGCTGCATGTTACAGATGACC -3'
(R):5'- GCTGTACTGCTCTGAAATGTGG -3'

Sequencing Primer
(F):5'- GCATGTTACAGATGACCTTCACGG -3'
(R):5'- CTCTGAAATGTGGGGTGGAGAC -3'
Posted On 2015-01-23