Incidental Mutation 'R3713:Foxred1'
ID259747
Institutional Source Beutler Lab
Gene Symbol Foxred1
Ensembl Gene ENSMUSG00000039048
Gene NameFAD-dependent oxidoreductase domain containing 1
SynonymsTex23, TEG-23
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3713 (G1)
Quality Score137
Status Validated
Chromosome9
Chromosomal Location35204206-35211055 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 35210890 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000123496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000127996] [ENSMUST00000132799] [ENSMUST00000135054] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000151658] [ENSMUST00000154691]
Predicted Effect probably benign
Transcript: ENSMUST00000034541
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably null
Transcript: ENSMUST00000043805
AA Change: M1T
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127996
AA Change: M1T
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135054
SMART Domains Protein: ENSMUSP00000115301
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
Pfam:DAO 3 140 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138287
Predicted Effect probably null
Transcript: ENSMUST00000138692
AA Change: M1T
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139703
AA Change: M1T
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140177
Predicted Effect probably null
Transcript: ENSMUST00000142595
AA Change: M1T
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect probably null
Transcript: ENSMUST00000151658
AA Change: M1T
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154691
AA Change: M1T
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216618
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a FAD-dependent oxidoreductase domain. The encoded protein is localized to the mitochondria and may function as a chaperone protein required for the function of mitochondrial complex I. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Foxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02163:Foxred1 APN 9 35205896 missense probably damaging 1.00
IGL02314:Foxred1 APN 9 35205968 missense probably damaging 1.00
IGL02379:Foxred1 APN 9 35209986 missense probably benign 0.44
IGL02558:Foxred1 APN 9 35210133 missense probably damaging 1.00
PIT4494001:Foxred1 UTSW 9 35209059 missense possibly damaging 0.95
R0220:Foxred1 UTSW 9 35209453 missense probably damaging 1.00
R0605:Foxred1 UTSW 9 35204882 missense possibly damaging 0.68
R0763:Foxred1 UTSW 9 35207473 splice site probably null
R1136:Foxred1 UTSW 9 35205037 missense probably benign 0.25
R1449:Foxred1 UTSW 9 35209442 missense probably damaging 1.00
R1757:Foxred1 UTSW 9 35210834 missense probably benign 0.16
R2157:Foxred1 UTSW 9 35205363 missense probably damaging 1.00
R2434:Foxred1 UTSW 9 35205658 missense probably damaging 0.99
R4012:Foxred1 UTSW 9 35206275 missense possibly damaging 0.48
R4666:Foxred1 UTSW 9 35210855 intron probably benign
R4934:Foxred1 UTSW 9 35209914 intron probably benign
R5488:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5489:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5828:Foxred1 UTSW 9 35210196 intron probably benign
R5840:Foxred1 UTSW 9 35210139 missense probably damaging 0.99
R7037:Foxred1 UTSW 9 35207548 missense probably benign 0.04
R7599:Foxred1 UTSW 9 35205636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCATACACTTGCCTCG -3'
(R):5'- TGACCAATAGCACACAGGG -3'

Sequencing Primer
(F):5'- AGCTAACTCGCTGTCCCG -3'
(R):5'- ACACAGGGGCGGGACTC -3'
Posted On2015-01-23