Incidental Mutation 'R3713:Neil1'
ID259748
Institutional Source Beutler Lab
Gene Symbol Neil1
Ensembl Gene ENSMUSG00000032298
Gene Namenei endonuclease VIII-like 1 (E. coli)
Synonyms2810450N13Rik
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57142800-57148305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57146970 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 22 (V22E)
Ref Sequence ENSEMBL: ENSMUSP00000139917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000034842] [ENSMUST00000160147] [ENSMUST00000161182] [ENSMUST00000186410] [ENSMUST00000190245]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034842
AA Change: V22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034842
Gene: ENSMUSG00000032298
AA Change: V22E

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect probably benign
Transcript: ENSMUST00000160147
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect probably damaging
Transcript: ENSMUST00000186410
AA Change: V22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141048
Gene: ENSMUSG00000032298
AA Change: V22E

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190245
AA Change: V22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139917
Gene: ENSMUSG00000032298
AA Change: V22E

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Meta Mutation Damage Score 0.3877 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nei endonuclease VIII-like gene family which encodes DNA glycosylases. The encoded enzyme participates in the DNA repair pathway by initiating base excision repair by removing damaged bases, primarily oxidized pyrimidines. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice develop severe obesity, dyslipidemia, fatty liver disease and tend to show hyperinsulinemia and increased mtDNA damage and deletions. Sporadic phenotypes include reduced subcutaneous fat, skin ulcers, joint inflammation, infertility,and tumors. Male heterozygotes become obese. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Neil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Neil1 APN 9 57143977 critical splice donor site probably null
IGL02587:Neil1 APN 9 57144979 missense probably damaging 1.00
IGL03192:Neil1 APN 9 57143535 missense probably benign
R0138:Neil1 UTSW 9 57143746 splice site probably benign
R0348:Neil1 UTSW 9 57146781 splice site probably null
R0356:Neil1 UTSW 9 57146896 missense possibly damaging 0.57
R1280:Neil1 UTSW 9 57146901 missense probably damaging 1.00
R1835:Neil1 UTSW 9 57146604 missense probably damaging 1.00
R1853:Neil1 UTSW 9 57144715 missense probably damaging 0.98
R1942:Neil1 UTSW 9 57146607 missense probably benign 0.00
R2272:Neil1 UTSW 9 57146785 missense probably damaging 1.00
R3116:Neil1 UTSW 9 57146663 missense probably benign
R3608:Neil1 UTSW 9 57144201 missense probably damaging 1.00
R4883:Neil1 UTSW 9 57146922 missense probably damaging 1.00
R5744:Neil1 UTSW 9 57144201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAAGGATCCTGACATC -3'
(R):5'- GCCTATCCTATATGGCGCTATGC -3'

Sequencing Primer
(F):5'- TGGAAGGATCCTGACATCCCAAAG -3'
(R):5'- GCGCTATGCCTCTCTGTG -3'
Posted On2015-01-23