Incidental Mutation 'R3713:Phactr2'
ID 259753
Institutional Source Beutler Lab
Gene Symbol Phactr2
Ensembl Gene ENSMUSG00000062866
Gene Name phosphatase and actin regulator 2
Synonyms
MMRRC Submission 040706-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3713 (G1)
Quality Score 153
Status Validated
Chromosome 10
Chromosomal Location 13083461-13350156 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) C to A at 13264476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079698] [ENSMUST00000105545] [ENSMUST00000105546]
AlphaFold B1AVP0
Predicted Effect probably benign
Transcript: ENSMUST00000079698
SMART Domains Protein: ENSMUSP00000078637
Gene: ENSMUSG00000062866

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 154 179 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
low complexity region 378 388 N/A INTRINSIC
RPEL 403 428 5.81e-8 SMART
RPEL 441 466 1.36e-8 SMART
RPEL 479 504 1.64e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105545
SMART Domains Protein: ENSMUSP00000101184
Gene: ENSMUSG00000062866

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 157 182 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 253 273 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
RPEL 406 431 5.81e-8 SMART
RPEL 444 469 1.36e-8 SMART
RPEL 482 507 1.64e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105546
SMART Domains Protein: ENSMUSP00000101185
Gene: ENSMUSG00000062866

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 133 144 N/A INTRINSIC
low complexity region 149 184 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 226 251 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
low complexity region 322 342 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
RPEL 475 500 5.81e-8 SMART
RPEL 513 538 1.36e-8 SMART
RPEL 551 576 1.64e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154265
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,424,081 (GRCm39) M137V probably benign Het
Aak1 T A 6: 86,932,172 (GRCm39) I381N probably benign Het
Abcd4 C T 12: 84,658,533 (GRCm39) M223I probably benign Het
Adgrf2 A G 17: 43,023,979 (GRCm39) V164A probably damaging Het
Ahdc1 G A 4: 132,793,297 (GRCm39) A1513T possibly damaging Het
Akap13 T C 7: 75,235,929 (GRCm39) M168T probably damaging Het
Aox1 C T 1: 58,095,374 (GRCm39) T196I probably benign Het
Aqr A G 2: 113,949,150 (GRCm39) probably benign Het
Astn1 A G 1: 158,495,102 (GRCm39) E1042G possibly damaging Het
Azi2 A G 9: 117,876,508 (GRCm39) D8G possibly damaging Het
Bcam T C 7: 19,498,118 (GRCm39) T302A probably benign Het
Cct6b A T 11: 82,651,183 (GRCm39) I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Ceacam5 G A 7: 17,493,263 (GRCm39) S762N possibly damaging Het
Cecr2 T C 6: 120,735,221 (GRCm39) L819P probably damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Chd2 A G 7: 73,121,538 (GRCm39) probably benign Het
Col7a1 G T 9: 108,793,508 (GRCm39) G1357* probably null Het
Cux1 A G 5: 136,594,397 (GRCm39) probably benign Het
Cwh43 A T 5: 73,595,835 (GRCm39) I535F probably damaging Het
Dexi A T 16: 10,360,553 (GRCm39) M1K probably null Het
Dnah12 T C 14: 26,534,747 (GRCm39) V2081A probably benign Het
Efcab5 A T 11: 77,007,008 (GRCm39) L872Q probably damaging Het
Enpp7 A G 11: 118,881,344 (GRCm39) Y163C probably damaging Het
Fam221a T C 6: 49,349,548 (GRCm39) Y38H probably damaging Het
Foxred1 A G 9: 35,122,186 (GRCm39) M1T probably null Het
Fscn3 C T 6: 28,428,091 (GRCm39) T26I possibly damaging Het
Galp A T 7: 6,216,836 (GRCm39) D72V probably damaging Het
Gm9843 A G 16: 76,200,419 (GRCm39) noncoding transcript Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Lmbrd1 T C 1: 24,732,076 (GRCm39) Y98H probably damaging Het
Lrrc63 T G 14: 75,344,776 (GRCm39) Y437S probably benign Het
Macc1 A G 12: 119,410,576 (GRCm39) E448G probably benign Het
Madcam1 A G 10: 79,504,194 (GRCm39) H404R probably benign Het
Mink1 G T 11: 70,499,776 (GRCm39) R773L possibly damaging Het
Mroh2b A G 15: 4,973,131 (GRCm39) I1045V probably benign Het
Mroh3 T C 1: 136,113,714 (GRCm39) T692A probably benign Het
Myo15a A T 11: 60,370,057 (GRCm39) E939V possibly damaging Het
Naip2 A G 13: 100,298,410 (GRCm39) F542S probably damaging Het
Napsa A G 7: 44,230,852 (GRCm39) Y73C probably damaging Het
Ndst4 A T 3: 125,355,154 (GRCm39) H354L possibly damaging Het
Neil1 A T 9: 57,054,254 (GRCm39) V22E probably damaging Het
Nol4 T C 18: 23,172,994 (GRCm39) I36V probably damaging Het
Nprl3 G A 11: 32,205,464 (GRCm39) T111I probably damaging Het
Or12k8 A G 2: 36,975,517 (GRCm39) M81T possibly damaging Het
Or1e26 A T 11: 73,479,731 (GRCm39) Y278N probably damaging Het
Or4p22 C A 2: 88,317,787 (GRCm39) T237N probably damaging Het
Pald1 G A 10: 61,178,144 (GRCm39) T624I possibly damaging Het
Pcdhb13 C T 18: 37,576,786 (GRCm39) P388L probably damaging Het
Pcdhga6 T C 18: 37,840,976 (GRCm39) V232A probably damaging Het
Pde6b A G 5: 108,570,928 (GRCm39) I388V probably damaging Het
Prdx5 T C 19: 6,885,477 (GRCm39) D56G probably damaging Het
Ptprh A T 7: 4,574,969 (GRCm39) I350N probably damaging Het
Rangap1 C A 15: 81,594,661 (GRCm39) E389D probably benign Het
Reln A G 5: 22,109,732 (GRCm39) V3126A probably damaging Het
Rpl21 G A 5: 146,771,847 (GRCm39) G59S possibly damaging Het
Rsph6a G A 7: 18,791,475 (GRCm39) V215M probably damaging Het
Smcp T C 3: 92,491,431 (GRCm39) K139E unknown Het
Stag1 A G 9: 100,771,671 (GRCm39) T699A probably benign Het
Tars3 G A 7: 65,338,700 (GRCm39) probably null Het
Tle1 G T 4: 72,044,659 (GRCm39) H459Q possibly damaging Het
Ttn G A 2: 76,561,363 (GRCm39) P27302S probably damaging Het
Ttn C T 2: 76,571,610 (GRCm39) V26428I probably damaging Het
Usp53 T C 3: 122,742,968 (GRCm39) E656G probably benign Het
Vmn1r218 A T 13: 23,321,081 (GRCm39) N63Y probably damaging Het
Vmn1r79 A G 7: 11,910,139 (GRCm39) N40S possibly damaging Het
Wdr35 A G 12: 9,077,648 (GRCm39) D1107G possibly damaging Het
Zfp101 A G 17: 33,600,880 (GRCm39) M292T probably benign Het
Zfp108 T A 7: 23,961,270 (GRCm39) C620* probably null Het
Zscan4b T C 7: 10,635,818 (GRCm39) T170A probably benign Het
Other mutations in Phactr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Phactr2 APN 10 13,121,279 (GRCm39) missense probably damaging 1.00
IGL01844:Phactr2 APN 10 13,129,181 (GRCm39) missense probably benign 0.05
IGL01893:Phactr2 APN 10 13,122,932 (GRCm39) missense probably benign 0.38
IGL02458:Phactr2 APN 10 13,137,572 (GRCm39) missense probably damaging 1.00
IGL02612:Phactr2 APN 10 13,121,167 (GRCm39) missense probably damaging 0.99
IGL02620:Phactr2 APN 10 13,167,632 (GRCm39) missense probably damaging 1.00
IGL03064:Phactr2 APN 10 13,264,457 (GRCm39) utr 5 prime probably benign
IGL03493:Phactr2 APN 10 13,133,413 (GRCm39) missense probably benign 0.02
R0973:Phactr2 UTSW 10 13,122,883 (GRCm39) missense possibly damaging 0.88
R0973:Phactr2 UTSW 10 13,122,883 (GRCm39) missense possibly damaging 0.88
R0974:Phactr2 UTSW 10 13,122,883 (GRCm39) missense possibly damaging 0.88
R1480:Phactr2 UTSW 10 13,129,536 (GRCm39) missense possibly damaging 0.74
R3115:Phactr2 UTSW 10 13,137,645 (GRCm39) nonsense probably null
R3116:Phactr2 UTSW 10 13,137,645 (GRCm39) nonsense probably null
R4367:Phactr2 UTSW 10 13,129,564 (GRCm39) missense probably damaging 1.00
R4368:Phactr2 UTSW 10 13,129,564 (GRCm39) missense probably damaging 1.00
R4371:Phactr2 UTSW 10 13,129,564 (GRCm39) missense probably damaging 1.00
R5344:Phactr2 UTSW 10 13,129,360 (GRCm39) missense possibly damaging 0.76
R5491:Phactr2 UTSW 10 13,137,590 (GRCm39) missense possibly damaging 0.91
R5617:Phactr2 UTSW 10 13,349,809 (GRCm39) missense possibly damaging 0.60
R5656:Phactr2 UTSW 10 13,264,447 (GRCm39) missense probably benign 0.34
R5895:Phactr2 UTSW 10 13,121,261 (GRCm39) missense probably damaging 1.00
R6051:Phactr2 UTSW 10 13,137,555 (GRCm39) splice site probably null 0.00
R6317:Phactr2 UTSW 10 13,137,626 (GRCm39) missense probably damaging 0.98
R7048:Phactr2 UTSW 10 13,121,168 (GRCm39) missense probably benign 0.28
R7101:Phactr2 UTSW 10 13,122,922 (GRCm39) missense probably benign 0.00
R7221:Phactr2 UTSW 10 13,122,783 (GRCm39) missense possibly damaging 0.58
R7868:Phactr2 UTSW 10 13,108,353 (GRCm39) missense probably damaging 1.00
R8408:Phactr2 UTSW 10 13,129,570 (GRCm39) missense probably damaging 1.00
R8865:Phactr2 UTSW 10 13,129,476 (GRCm39) missense probably benign 0.00
R9095:Phactr2 UTSW 10 13,129,386 (GRCm39) missense probably benign 0.26
R9443:Phactr2 UTSW 10 13,122,841 (GRCm39) missense probably benign 0.00
R9572:Phactr2 UTSW 10 13,264,561 (GRCm39) unclassified probably benign
R9695:Phactr2 UTSW 10 13,349,908 (GRCm39) missense unknown
RF023:Phactr2 UTSW 10 13,121,178 (GRCm39) missense probably benign 0.10
X0026:Phactr2 UTSW 10 13,133,378 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGTCAATGCATCATCAGGG -3'
(R):5'- CACTTGATAGGCGCACTCTC -3'

Sequencing Primer
(F):5'- GGGTTAATATACTGCATGCTTCCCAG -3'
(R):5'- GATAGGCGCACTCTCTTAATCAG -3'
Posted On 2015-01-23