Incidental Mutation 'R3713:Nprl3'
ID 259757
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 040706-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R3713 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32205464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 111 (T111I)
Ref Sequence ENSEMBL: ENSMUSP00000123219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000129010] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: T98I

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: T98I

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: T98I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: T98I

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129010
AA Change: T111I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289
AA Change: T111I

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Meta Mutation Damage Score 0.4829 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,424,081 (GRCm39) M137V probably benign Het
Aak1 T A 6: 86,932,172 (GRCm39) I381N probably benign Het
Abcd4 C T 12: 84,658,533 (GRCm39) M223I probably benign Het
Adgrf2 A G 17: 43,023,979 (GRCm39) V164A probably damaging Het
Ahdc1 G A 4: 132,793,297 (GRCm39) A1513T possibly damaging Het
Akap13 T C 7: 75,235,929 (GRCm39) M168T probably damaging Het
Aox1 C T 1: 58,095,374 (GRCm39) T196I probably benign Het
Aqr A G 2: 113,949,150 (GRCm39) probably benign Het
Astn1 A G 1: 158,495,102 (GRCm39) E1042G possibly damaging Het
Azi2 A G 9: 117,876,508 (GRCm39) D8G possibly damaging Het
Bcam T C 7: 19,498,118 (GRCm39) T302A probably benign Het
Cct6b A T 11: 82,651,183 (GRCm39) I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Ceacam5 G A 7: 17,493,263 (GRCm39) S762N possibly damaging Het
Cecr2 T C 6: 120,735,221 (GRCm39) L819P probably damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Chd2 A G 7: 73,121,538 (GRCm39) probably benign Het
Col7a1 G T 9: 108,793,508 (GRCm39) G1357* probably null Het
Cux1 A G 5: 136,594,397 (GRCm39) probably benign Het
Cwh43 A T 5: 73,595,835 (GRCm39) I535F probably damaging Het
Dexi A T 16: 10,360,553 (GRCm39) M1K probably null Het
Dnah12 T C 14: 26,534,747 (GRCm39) V2081A probably benign Het
Efcab5 A T 11: 77,007,008 (GRCm39) L872Q probably damaging Het
Enpp7 A G 11: 118,881,344 (GRCm39) Y163C probably damaging Het
Fam221a T C 6: 49,349,548 (GRCm39) Y38H probably damaging Het
Foxred1 A G 9: 35,122,186 (GRCm39) M1T probably null Het
Fscn3 C T 6: 28,428,091 (GRCm39) T26I possibly damaging Het
Galp A T 7: 6,216,836 (GRCm39) D72V probably damaging Het
Gm9843 A G 16: 76,200,419 (GRCm39) noncoding transcript Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Lmbrd1 T C 1: 24,732,076 (GRCm39) Y98H probably damaging Het
Lrrc63 T G 14: 75,344,776 (GRCm39) Y437S probably benign Het
Macc1 A G 12: 119,410,576 (GRCm39) E448G probably benign Het
Madcam1 A G 10: 79,504,194 (GRCm39) H404R probably benign Het
Mink1 G T 11: 70,499,776 (GRCm39) R773L possibly damaging Het
Mroh2b A G 15: 4,973,131 (GRCm39) I1045V probably benign Het
Mroh3 T C 1: 136,113,714 (GRCm39) T692A probably benign Het
Myo15a A T 11: 60,370,057 (GRCm39) E939V possibly damaging Het
Naip2 A G 13: 100,298,410 (GRCm39) F542S probably damaging Het
Napsa A G 7: 44,230,852 (GRCm39) Y73C probably damaging Het
Ndst4 A T 3: 125,355,154 (GRCm39) H354L possibly damaging Het
Neil1 A T 9: 57,054,254 (GRCm39) V22E probably damaging Het
Nol4 T C 18: 23,172,994 (GRCm39) I36V probably damaging Het
Or12k8 A G 2: 36,975,517 (GRCm39) M81T possibly damaging Het
Or1e26 A T 11: 73,479,731 (GRCm39) Y278N probably damaging Het
Or4p22 C A 2: 88,317,787 (GRCm39) T237N probably damaging Het
Pald1 G A 10: 61,178,144 (GRCm39) T624I possibly damaging Het
Pcdhb13 C T 18: 37,576,786 (GRCm39) P388L probably damaging Het
Pcdhga6 T C 18: 37,840,976 (GRCm39) V232A probably damaging Het
Pde6b A G 5: 108,570,928 (GRCm39) I388V probably damaging Het
Phactr2 C A 10: 13,264,476 (GRCm39) probably benign Het
Prdx5 T C 19: 6,885,477 (GRCm39) D56G probably damaging Het
Ptprh A T 7: 4,574,969 (GRCm39) I350N probably damaging Het
Rangap1 C A 15: 81,594,661 (GRCm39) E389D probably benign Het
Reln A G 5: 22,109,732 (GRCm39) V3126A probably damaging Het
Rpl21 G A 5: 146,771,847 (GRCm39) G59S possibly damaging Het
Rsph6a G A 7: 18,791,475 (GRCm39) V215M probably damaging Het
Smcp T C 3: 92,491,431 (GRCm39) K139E unknown Het
Stag1 A G 9: 100,771,671 (GRCm39) T699A probably benign Het
Tars3 G A 7: 65,338,700 (GRCm39) probably null Het
Tle1 G T 4: 72,044,659 (GRCm39) H459Q possibly damaging Het
Ttn G A 2: 76,561,363 (GRCm39) P27302S probably damaging Het
Ttn C T 2: 76,571,610 (GRCm39) V26428I probably damaging Het
Usp53 T C 3: 122,742,968 (GRCm39) E656G probably benign Het
Vmn1r218 A T 13: 23,321,081 (GRCm39) N63Y probably damaging Het
Vmn1r79 A G 7: 11,910,139 (GRCm39) N40S possibly damaging Het
Wdr35 A G 12: 9,077,648 (GRCm39) D1107G possibly damaging Het
Zfp101 A G 17: 33,600,880 (GRCm39) M292T probably benign Het
Zfp108 T A 7: 23,961,270 (GRCm39) C620* probably null Het
Zscan4b T C 7: 10,635,818 (GRCm39) T170A probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTAATGCCCTGGTCCTAGGAAG -3'
(R):5'- AACTGTCATTTCCTGAGCCAC -3'

Sequencing Primer
(F):5'- TCCTAGGAAGGCGTACAGC -3'
(R):5'- GAGCCACTCCCCACTTGTG -3'
Posted On 2015-01-23