Mutagenetix > Incidental Mutations

Incidental Mutation 'R3713:Mink1'

259759

Institutional Source

Beutler Lab

Gene Symbol

Mink1

Ensembl Gene

ENSMUSG00000020827

Gene Name

misshapen-like kinase 1 (zebrafish)

Synonyms

Map4k6, Ysk2, MINK, Misshapen/NIKs-related kinase

MMRRC Submission

040706-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70562881-70614483 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70608950 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 773 (R773L)

Ref Sequence

ENSEMBL: ENSMUSP00000072091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072237
AA Change: R773L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: R773L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	837	874	N/A	INTRINSIC
CNH	1026	1324	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072873
AA Change: R773L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: R773L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	829	853	N/A	INTRINSIC
CNH	1019	1317	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079244
AA Change: R770L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: R770L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	314	338	N/A	INTRINSIC
coiled coil region	348	493	N/A	INTRINSIC
low complexity region	554	566	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	643	656	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	826	850	N/A	INTRINSIC
CNH	1016	1314	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102558
AA Change: R736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: R736L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	792	816	N/A	INTRINSIC
CNH	982	1280	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102559
AA Change: R736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: R736L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	800	824	N/A	INTRINSIC
CNH	990	1288	1.58e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133310

Predicted Effect

unknown
Transcript: ENSMUST00000136663
AA Change: R626L

SMART Domains

Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: R626L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	140	2.3e-22	PFAM
Pfam:Pkinase	1	143	1.6e-30	PFAM
low complexity region	161	192	N/A	INTRINSIC
coiled coil region	204	349	N/A	INTRINSIC
low complexity region	411	423	N/A	INTRINSIC
low complexity region	474	487	N/A	INTRINSIC
low complexity region	500	513	N/A	INTRINSIC
low complexity region	573	592	N/A	INTRINSIC
low complexity region	691	728	N/A	INTRINSIC
CNH	880	1178	1.58e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142650

Predicted Effect

probably benign
Transcript: ENSMUST00000149845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153503

Predicted Effect

probably benign
Transcript: ENSMUST00000178764

Meta Mutation Damage Score

0.0796

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	T	C	16: 88,627,193	M137V	probably benign	Het
Aak1	T	A	6: 86,955,190	I381N	probably benign	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adgrf2	A	G	17: 42,713,088	V164A	probably damaging	Het
Ahdc1	G	A	4: 133,065,986	A1513T	possibly damaging	Het
Akap13	T	C	7: 75,586,181	M168T	probably damaging	Het
Aox1	C	T	1: 58,056,215	T196I	probably benign	Het
Aqr	A	G	2: 114,118,669		probably benign	Het
Astn1	A	G	1: 158,667,532	E1042G	possibly damaging	Het
Azi2	A	G	9: 118,047,440	D8G	possibly damaging	Het
Bcam	T	C	7: 19,764,193	T302A	probably benign	Het
Cct6b	A	T	11: 82,760,357	I110N	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Ceacam5	G	A	7: 17,759,338	S762N	possibly damaging	Het
Cecr2	T	C	6: 120,758,260	L819P	probably damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Chd2	A	G	7: 73,471,790		probably benign	Het
Col7a1	G	T	9: 108,964,440	G1357*	probably null	Het
Cux1	A	G	5: 136,565,543		probably benign	Het
Cwh43	A	T	5: 73,438,492	I535F	probably damaging	Het
Dexi	A	T	16: 10,542,689	M1K	probably null	Het
Dnah12	T	C	14: 26,812,790	V2081A	probably benign	Het
Efcab5	A	T	11: 77,116,182	L872Q	probably damaging	Het
Enpp7	A	G	11: 118,990,518	Y163C	probably damaging	Het
Fam221a	T	C	6: 49,372,614	Y38H	probably damaging	Het
Foxred1	A	G	9: 35,210,890	M1T	probably null	Het
Fscn3	C	T	6: 28,428,092	T26I	possibly damaging	Het
Galp	A	T	7: 6,213,837	D72V	probably damaging	Het
Gm9843	A	G	16: 76,403,531		noncoding transcript	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Lmbrd1	T	C	1: 24,692,995	Y98H	probably damaging	Het
Lrrc63	T	G	14: 75,107,336	Y437S	probably benign	Het
Macc1	A	G	12: 119,446,841	E448G	probably benign	Het
Madcam1	A	G	10: 79,668,360	H404R	probably benign	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Mroh3	T	C	1: 136,185,976	T692A	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Naip2	A	G	13: 100,161,902	F542S	probably damaging	Het
Napsa	A	G	7: 44,581,428	Y73C	probably damaging	Het
Ndst4	A	T	3: 125,561,505	H354L	possibly damaging	Het
Neil1	A	T	9: 57,146,970	V22E	probably damaging	Het
Nol4	T	C	18: 23,039,937	I36V	probably damaging	Het
Nprl3	G	A	11: 32,255,464	T111I	probably damaging	Het
Olfr1184	C	A	2: 88,487,443	T237N	probably damaging	Het
Olfr361	A	G	2: 37,085,505	M81T	possibly damaging	Het
Olfr385	A	T	11: 73,588,905	Y278N	probably damaging	Het
Pald1	G	A	10: 61,342,365	T624I	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,733	P388L	probably damaging	Het
Pcdhga6	T	C	18: 37,707,923	V232A	probably damaging	Het
Pde6b	A	G	5: 108,423,062	I388V	probably damaging	Het
Phactr2	C	A	10: 13,388,732		probably benign	Het
Prdx5	T	C	19: 6,908,109	D56G	probably damaging	Het
Ptprh	A	T	7: 4,571,970	I350N	probably damaging	Het
Rangap1	C	A	15: 81,710,460	E389D	probably benign	Het
Reln	A	G	5: 21,904,734	V3126A	probably damaging	Het
Rpl21	G	A	5: 146,835,037	G59S	possibly damaging	Het
Rsph6a	G	A	7: 19,057,550	V215M	probably damaging	Het
Smcp	T	C	3: 92,584,124	K139E	unknown	Het
Stag1	A	G	9: 100,889,618	T699A	probably benign	Het
Tarsl2	G	A	7: 65,688,952		probably null	Het
Tle1	G	T	4: 72,126,422	H459Q	possibly damaging	Het
Ttn	G	A	2: 76,731,019	P27302S	probably damaging	Het
Ttn	C	T	2: 76,741,266	V26428I	probably damaging	Het
Usp53	T	C	3: 122,949,319	E656G	probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vmn1r79	A	G	7: 12,176,212	N40S	possibly damaging	Het
Wdr35	A	G	12: 9,027,648	D1107G	possibly damaging	Het
Zfp101	A	G	17: 33,381,906	M292T	probably benign	Het
Zfp108	T	A	7: 24,261,845	C620*	probably null	Het
Zscan4b	T	C	7: 10,901,891	T170A	probably benign	Het

Other mutations in Mink1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Mink1	APN	11	70603812	missense	probably damaging	0.99
IGL00709:Mink1	APN	11	70613019	missense	probably damaging	0.99
IGL01064:Mink1	APN	11	70603481	missense	probably benign	0.05
IGL02612:Mink1	APN	11	70597226	missense	probably damaging	1.00
IGL02797:Mink1	APN	11	70610350	missense	probably damaging	1.00
IGL03056:Mink1	APN	11	70612583	critical splice donor site	probably null
IGL03066:Mink1	APN	11	70608889	missense	probably benign	0.01
IGL03185:Mink1	APN	11	70603860	missense	probably damaging	1.00
PIT4498001:Mink1	UTSW	11	70598888	missense	probably benign	0.05
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0488:Mink1	UTSW	11	70597204	missense	probably damaging	1.00
R0637:Mink1	UTSW	11	70601676	missense	probably damaging	0.96
R0828:Mink1	UTSW	11	70610145	nonsense	probably null
R1081:Mink1	UTSW	11	70607035	missense	probably benign	0.07
R1175:Mink1	UTSW	11	70611340	missense	probably benign	0.02
R1441:Mink1	UTSW	11	70607114	missense	possibly damaging	0.72
R1532:Mink1	UTSW	11	70602007	missense	probably null	1.00
R1545:Mink1	UTSW	11	70598891	missense	possibly damaging	0.60
R1634:Mink1	UTSW	11	70608880	missense	probably benign	0.00
R1932:Mink1	UTSW	11	70608428	critical splice donor site	probably null
R2033:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R2184:Mink1	UTSW	11	70603797	missense	probably damaging	1.00
R2267:Mink1	UTSW	11	70601724	splice site	probably null
R2268:Mink1	UTSW	11	70601724	splice site	probably null
R2859:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R3714:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3715:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3716:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R3717:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R4607:Mink1	UTSW	11	70606067	missense	possibly damaging	0.72
R4735:Mink1	UTSW	11	70609260	splice site	probably null
R4790:Mink1	UTSW	11	70599041	missense	probably damaging	0.99
R4847:Mink1	UTSW	11	70602028	missense	probably damaging	1.00
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R5081:Mink1	UTSW	11	70605144	missense	probably damaging	0.98
R5310:Mink1	UTSW	11	70607343	missense	probably benign	0.33
R5677:Mink1	UTSW	11	70605165	missense	possibly damaging	0.66
R5767:Mink1	UTSW	11	70606075	missense	possibly damaging	0.53
R5795:Mink1	UTSW	11	70607790	missense	possibly damaging	0.86
R5888:Mink1	UTSW	11	70610059	unclassified	probably benign
R5950:Mink1	UTSW	11	70609586	missense	possibly damaging	0.81
R6024:Mink1	UTSW	11	70599089	missense	possibly damaging	0.71
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6058:Mink1	UTSW	11	70611720	missense	possibly damaging	0.96
R6144:Mink1	UTSW	11	70610652	missense	possibly damaging	0.66
R6154:Mink1	UTSW	11	70610101	missense	possibly damaging	0.46
R6218:Mink1	UTSW	11	70598894	missense	possibly damaging	0.94
R6262:Mink1	UTSW	11	70603325	splice site	probably null
R6269:Mink1	UTSW	11	70598987	missense	probably damaging	1.00
R6273:Mink1	UTSW	11	70611435	nonsense	probably null
R6301:Mink1	UTSW	11	70612294	missense	possibly damaging	0.71
R6603:Mink1	UTSW	11	70609593	missense	probably damaging	0.96
R6876:Mink1	UTSW	11	70607435	missense	probably benign	0.02
R7030:Mink1	UTSW	11	70607775	missense	possibly damaging	0.46
R7050:Mink1	UTSW	11	70612332	missense	possibly damaging	0.93
R7094:Mink1	UTSW	11	70610075	splice site	probably null
R7135:Mink1	UTSW	11	70603503	missense	probably damaging	1.00
R7238:Mink1	UTSW	11	70611479	critical splice donor site	probably null
R7320:Mink1	UTSW	11	70599073	missense	probably benign	0.23
R7396:Mink1	UTSW	11	70605168	missense	possibly damaging	0.73
R7446:Mink1	UTSW	11	70609629	missense	probably benign	0.18
R7723:Mink1	UTSW	11	70612910	missense	probably benign	0.16
R7896:Mink1	UTSW	11	70612282	missense	possibly damaging	0.71
R8058:Mink1	UTSW	11	70603768	nonsense	probably null
R8082:Mink1	UTSW	11	70613277	missense	possibly damaging	0.71
R8160:Mink1	UTSW	11	70606081	nonsense	probably null
R8335:Mink1	UTSW	11	70609575	missense	probably damaging	0.97
R8353:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70
R8453:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCTAGGTAATGGAGTTGCCCC -3'
(R):5'- TATCTACAGAATGGGCCCGG -3'

Sequencing Primer
(F):5'- TAATGGAGTTGCCCCCTGAC -3'
(R):5'- GGTCCTAGGCCACCAAA -3'

Posted On

2015-01-23