Incidental Mutation 'R3713:Or1e26'
ID 259760
Institutional Source Beutler Lab
Gene Symbol Or1e26
Ensembl Gene ENSMUSG00000095095
Gene Name olfactory receptor family 1 subfamily E member 26
Synonyms Olfr385, GA_x6K02T2P1NL-3760313-3759375, MOR135-3
MMRRC Submission 040706-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R3713 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 73479624-73480562 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73479731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 278 (Y278N)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
AlphaFold Q8VGT1
Predicted Effect probably damaging
Transcript: ENSMUST00000071553
AA Change: Y278N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: Y278N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215689
AA Change: Y278N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3631 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,424,081 (GRCm39) M137V probably benign Het
Aak1 T A 6: 86,932,172 (GRCm39) I381N probably benign Het
Abcd4 C T 12: 84,658,533 (GRCm39) M223I probably benign Het
Adgrf2 A G 17: 43,023,979 (GRCm39) V164A probably damaging Het
Ahdc1 G A 4: 132,793,297 (GRCm39) A1513T possibly damaging Het
Akap13 T C 7: 75,235,929 (GRCm39) M168T probably damaging Het
Aox1 C T 1: 58,095,374 (GRCm39) T196I probably benign Het
Aqr A G 2: 113,949,150 (GRCm39) probably benign Het
Astn1 A G 1: 158,495,102 (GRCm39) E1042G possibly damaging Het
Azi2 A G 9: 117,876,508 (GRCm39) D8G possibly damaging Het
Bcam T C 7: 19,498,118 (GRCm39) T302A probably benign Het
Cct6b A T 11: 82,651,183 (GRCm39) I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Ceacam5 G A 7: 17,493,263 (GRCm39) S762N possibly damaging Het
Cecr2 T C 6: 120,735,221 (GRCm39) L819P probably damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Chd2 A G 7: 73,121,538 (GRCm39) probably benign Het
Col7a1 G T 9: 108,793,508 (GRCm39) G1357* probably null Het
Cux1 A G 5: 136,594,397 (GRCm39) probably benign Het
Cwh43 A T 5: 73,595,835 (GRCm39) I535F probably damaging Het
Dexi A T 16: 10,360,553 (GRCm39) M1K probably null Het
Dnah12 T C 14: 26,534,747 (GRCm39) V2081A probably benign Het
Efcab5 A T 11: 77,007,008 (GRCm39) L872Q probably damaging Het
Enpp7 A G 11: 118,881,344 (GRCm39) Y163C probably damaging Het
Fam221a T C 6: 49,349,548 (GRCm39) Y38H probably damaging Het
Foxred1 A G 9: 35,122,186 (GRCm39) M1T probably null Het
Fscn3 C T 6: 28,428,091 (GRCm39) T26I possibly damaging Het
Galp A T 7: 6,216,836 (GRCm39) D72V probably damaging Het
Gm9843 A G 16: 76,200,419 (GRCm39) noncoding transcript Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Lmbrd1 T C 1: 24,732,076 (GRCm39) Y98H probably damaging Het
Lrrc63 T G 14: 75,344,776 (GRCm39) Y437S probably benign Het
Macc1 A G 12: 119,410,576 (GRCm39) E448G probably benign Het
Madcam1 A G 10: 79,504,194 (GRCm39) H404R probably benign Het
Mink1 G T 11: 70,499,776 (GRCm39) R773L possibly damaging Het
Mroh2b A G 15: 4,973,131 (GRCm39) I1045V probably benign Het
Mroh3 T C 1: 136,113,714 (GRCm39) T692A probably benign Het
Myo15a A T 11: 60,370,057 (GRCm39) E939V possibly damaging Het
Naip2 A G 13: 100,298,410 (GRCm39) F542S probably damaging Het
Napsa A G 7: 44,230,852 (GRCm39) Y73C probably damaging Het
Ndst4 A T 3: 125,355,154 (GRCm39) H354L possibly damaging Het
Neil1 A T 9: 57,054,254 (GRCm39) V22E probably damaging Het
Nol4 T C 18: 23,172,994 (GRCm39) I36V probably damaging Het
Nprl3 G A 11: 32,205,464 (GRCm39) T111I probably damaging Het
Or12k8 A G 2: 36,975,517 (GRCm39) M81T possibly damaging Het
Or4p22 C A 2: 88,317,787 (GRCm39) T237N probably damaging Het
Pald1 G A 10: 61,178,144 (GRCm39) T624I possibly damaging Het
Pcdhb13 C T 18: 37,576,786 (GRCm39) P388L probably damaging Het
Pcdhga6 T C 18: 37,840,976 (GRCm39) V232A probably damaging Het
Pde6b A G 5: 108,570,928 (GRCm39) I388V probably damaging Het
Phactr2 C A 10: 13,264,476 (GRCm39) probably benign Het
Prdx5 T C 19: 6,885,477 (GRCm39) D56G probably damaging Het
Ptprh A T 7: 4,574,969 (GRCm39) I350N probably damaging Het
Rangap1 C A 15: 81,594,661 (GRCm39) E389D probably benign Het
Reln A G 5: 22,109,732 (GRCm39) V3126A probably damaging Het
Rpl21 G A 5: 146,771,847 (GRCm39) G59S possibly damaging Het
Rsph6a G A 7: 18,791,475 (GRCm39) V215M probably damaging Het
Smcp T C 3: 92,491,431 (GRCm39) K139E unknown Het
Stag1 A G 9: 100,771,671 (GRCm39) T699A probably benign Het
Tars3 G A 7: 65,338,700 (GRCm39) probably null Het
Tle1 G T 4: 72,044,659 (GRCm39) H459Q possibly damaging Het
Ttn G A 2: 76,561,363 (GRCm39) P27302S probably damaging Het
Ttn C T 2: 76,571,610 (GRCm39) V26428I probably damaging Het
Usp53 T C 3: 122,742,968 (GRCm39) E656G probably benign Het
Vmn1r218 A T 13: 23,321,081 (GRCm39) N63Y probably damaging Het
Vmn1r79 A G 7: 11,910,139 (GRCm39) N40S possibly damaging Het
Wdr35 A G 12: 9,077,648 (GRCm39) D1107G possibly damaging Het
Zfp101 A G 17: 33,600,880 (GRCm39) M292T probably benign Het
Zfp108 T A 7: 23,961,270 (GRCm39) C620* probably null Het
Zscan4b T C 7: 10,635,818 (GRCm39) T170A probably benign Het
Other mutations in Or1e26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Or1e26 APN 11 73,480,209 (GRCm39) missense probably benign 0.34
IGL02045:Or1e26 APN 11 73,480,058 (GRCm39) missense probably damaging 1.00
IGL02324:Or1e26 APN 11 73,480,081 (GRCm39) missense probably benign 0.02
IGL02328:Or1e26 APN 11 73,480,081 (GRCm39) missense probably benign 0.02
IGL02562:Or1e26 APN 11 73,480,237 (GRCm39) missense probably benign
IGL02715:Or1e26 APN 11 73,479,947 (GRCm39) missense probably benign 0.00
IGL03182:Or1e26 APN 11 73,480,268 (GRCm39) missense probably benign 0.04
IGL03048:Or1e26 UTSW 11 73,479,831 (GRCm39) missense possibly damaging 0.56
R0346:Or1e26 UTSW 11 73,480,283 (GRCm39) missense probably damaging 1.00
R0675:Or1e26 UTSW 11 73,480,078 (GRCm39) missense probably damaging 1.00
R0751:Or1e26 UTSW 11 73,479,970 (GRCm39) missense probably benign 0.02
R1220:Or1e26 UTSW 11 73,480,203 (GRCm39) nonsense probably null
R1389:Or1e26 UTSW 11 73,480,369 (GRCm39) missense possibly damaging 0.88
R1484:Or1e26 UTSW 11 73,480,187 (GRCm39) missense possibly damaging 0.91
R1619:Or1e26 UTSW 11 73,480,118 (GRCm39) missense probably damaging 1.00
R2290:Or1e26 UTSW 11 73,479,745 (GRCm39) missense probably benign 0.37
R3781:Or1e26 UTSW 11 73,480,194 (GRCm39) nonsense probably null
R3781:Or1e26 UTSW 11 73,479,839 (GRCm39) missense probably damaging 1.00
R3782:Or1e26 UTSW 11 73,480,194 (GRCm39) nonsense probably null
R3782:Or1e26 UTSW 11 73,479,839 (GRCm39) missense probably damaging 1.00
R4402:Or1e26 UTSW 11 73,480,081 (GRCm39) missense probably benign 0.02
R4721:Or1e26 UTSW 11 73,480,273 (GRCm39) missense probably damaging 1.00
R5157:Or1e26 UTSW 11 73,480,549 (GRCm39) missense probably damaging 1.00
R5995:Or1e26 UTSW 11 73,480,076 (GRCm39) missense probably benign
R6373:Or1e26 UTSW 11 73,479,724 (GRCm39) missense probably benign 0.42
R6658:Or1e26 UTSW 11 73,479,874 (GRCm39) missense probably damaging 0.99
R7046:Or1e26 UTSW 11 73,480,558 (GRCm39) missense probably benign
R7096:Or1e26 UTSW 11 73,480,463 (GRCm39) missense probably benign 0.03
R7238:Or1e26 UTSW 11 73,480,561 (GRCm39) start codon destroyed probably null 0.99
R7537:Or1e26 UTSW 11 73,480,094 (GRCm39) missense probably benign 0.04
R7548:Or1e26 UTSW 11 73,479,802 (GRCm39) missense possibly damaging 0.56
R7888:Or1e26 UTSW 11 73,480,354 (GRCm39) missense probably damaging 0.99
R7968:Or1e26 UTSW 11 73,480,154 (GRCm39) missense probably benign 0.05
R8923:Or1e26 UTSW 11 73,480,076 (GRCm39) missense probably benign
R9006:Or1e26 UTSW 11 73,480,036 (GRCm39) missense probably benign 0.40
R9281:Or1e26 UTSW 11 73,480,133 (GRCm39) missense probably benign
R9689:Or1e26 UTSW 11 73,479,686 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACTTTGGTAGATGCAAAC -3'
(R):5'- GTCCTATGTACAAATTGTCTGCTC -3'

Sequencing Primer
(F):5'- GTCTAAATGCAAGTATTGCCAT -3'
(R):5'- CCATTCTAAAGTTTTCATCTACACGG -3'
Posted On 2015-01-23