Incidental Mutation 'R3713:Cct6b'
ID259762
Institutional Source Beutler Lab
Gene Symbol Cct6b
Ensembl Gene ENSMUSG00000020698
Gene Namechaperonin containing Tcp1, subunit 6b (zeta)
SynonymsCCTzeta-2, Cctz-2
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82719250-82764321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82760357 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 110 (I110N)
Ref Sequence ENSEMBL: ENSMUSP00000021040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021040] [ENSMUST00000056677] [ENSMUST00000100722]
Predicted Effect probably damaging
Transcript: ENSMUST00000021040
AA Change: I110N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021040
Gene: ENSMUSG00000020698
AA Change: I110N

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 30 526 1.1e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056677
SMART Domains Protein: ENSMUSP00000056154
Gene: ENSMUSG00000046010

DomainStartEndE-ValueType
coiled coil region 13 40 N/A INTRINSIC
Blast:ZnF_U1 48 82 4e-10 BLAST
low complexity region 129 143 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
coiled coil region 303 331 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100722
AA Change: I71N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098288
Gene: ENSMUSG00000020698
AA Change: I71N

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 4 486 9.7e-140 PFAM
Meta Mutation Damage Score 0.9226 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin-containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Cct6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Cct6b APN 11 82741391 missense probably damaging 1.00
IGL02606:Cct6b APN 11 82736445 missense probably damaging 1.00
IGL02707:Cct6b APN 11 82754954 splice site probably benign
IGL03081:Cct6b APN 11 82764169 nonsense probably null
R0032:Cct6b UTSW 11 82753643 missense possibly damaging 0.87
R0395:Cct6b UTSW 11 82739680 missense probably benign
R0556:Cct6b UTSW 11 82719444 splice site probably benign
R0631:Cct6b UTSW 11 82737088 splice site probably null
R1456:Cct6b UTSW 11 82753620 splice site probably benign
R4791:Cct6b UTSW 11 82742004 splice site probably null
R5154:Cct6b UTSW 11 82739695 missense probably damaging 1.00
R5256:Cct6b UTSW 11 82764220 missense probably damaging 0.98
R5338:Cct6b UTSW 11 82762189 missense possibly damaging 0.94
R5455:Cct6b UTSW 11 82755117 missense probably benign 0.04
R5560:Cct6b UTSW 11 82741413 missense probably damaging 1.00
R5616:Cct6b UTSW 11 82741349 missense probably damaging 1.00
R5644:Cct6b UTSW 11 82722455 missense probably benign 0.02
R6862:Cct6b UTSW 11 82719959 missense probably damaging 1.00
R7960:Cct6b UTSW 11 82741395 missense possibly damaging 0.94
R8240:Cct6b UTSW 11 82723824 missense probably damaging 1.00
X0060:Cct6b UTSW 11 82741310 missense probably benign 0.00
Z1176:Cct6b UTSW 11 82723939 missense probably damaging 1.00
Z1176:Cct6b UTSW 11 82764065 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGTACACGGGAGCTTTC -3'
(R):5'- CAGTGGCTTTCCGCATCATAG -3'

Sequencing Primer
(F):5'- GGTACACGGGAGCTTTCTCTTTAAC -3'
(R):5'- GTGGCTTTCCGCATCATAGTTTCTG -3'
Posted On2015-01-23