Incidental Mutation 'R3713:Wdr35'
ID259764
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9027648 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1107 (D1107G)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085741] [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000219470] [ENSMUST00000219488]
Predicted Effect probably benign
Transcript: ENSMUST00000085741
SMART Domains Protein: ENSMUSP00000082891
Gene: ENSMUSG00000066637

DomainStartEndE-ValueType
Pfam:TPR_9 12 58 1.2e-2 PFAM
Pfam:TPR_12 51 121 1e-9 PFAM
Pfam:TPR_11 53 120 1.2e-14 PFAM
Pfam:TPR_1 55 88 3.5e-6 PFAM
Pfam:TPR_9 70 134 4.9e-7 PFAM
Pfam:TPR_1 90 122 1e-10 PFAM
Pfam:TPR_2 91 122 8.3e-11 PFAM
Pfam:TPR_8 91 122 2.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085745
AA Change: D1107G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: D1107G

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: D1096G

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: D1096G

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Predicted Effect probably benign
Transcript: ENSMUST00000219470
Predicted Effect probably benign
Transcript: ENSMUST00000219488
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGCTCTTCACCTGAGAGAC -3'
(R):5'- ACGTGATTGGTCTGTCTACTCTAC -3'

Sequencing Primer
(F):5'- GCTCTTCACCTGAGAGACTATGAAG -3'
(R):5'- AGCTTTACTACACTCATGTAG -3'
Posted On2015-01-23