Incidental Mutation 'R3713:Macc1'
ID259767
Institutional Source Beutler Lab
Gene Symbol Macc1
Ensembl Gene ENSMUSG00000041886
Gene Namemetastasis associated in colon cancer 1
Synonyms
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location119314270-119469987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119446841 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 448 (E448G)
Ref Sequence ENSEMBL: ENSMUSP00000152677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048880] [ENSMUST00000221866] [ENSMUST00000221917] [ENSMUST00000222058] [ENSMUST00000222784]
Predicted Effect probably benign
Transcript: ENSMUST00000048880
AA Change: E448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042955
Gene: ENSMUSG00000041886
AA Change: E448G

DomainStartEndE-ValueType
low complexity region 127 141 N/A INTRINSIC
Pfam:ZU5 213 307 3.5e-10 PFAM
SH3 551 617 3.74e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221866
AA Change: E448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221917
AA Change: E448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222058
AA Change: E448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222784
AA Change: E448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MACC1 is a key regulator of the hepatocyte growth factor (HGF; MIM 142409)-HGF receptor (HGFR, or MET; MIM 164860) pathway, which is involved in cellular growth, epithelial-mesenchymal transition, angiogenesis, cell motility, invasiveness, and metastasis. Expression of MACC1 in colon cancer (MIM 114500) specimens is an independent prognostic indicator for metastasis formation and metastasis-free survival (Stein et al., 2009 [PubMed 19098908]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Macc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Macc1 APN 12 119447014 missense probably benign 0.16
IGL01515:Macc1 APN 12 119450371 missense probably damaging 1.00
IGL01638:Macc1 APN 12 119446511 missense probably benign 0.00
IGL01653:Macc1 APN 12 119450353 missense probably damaging 1.00
IGL01982:Macc1 APN 12 119445634 missense probably benign 0.12
IGL02177:Macc1 APN 12 119465557 missense probably damaging 1.00
IGL02263:Macc1 APN 12 119446017 missense possibly damaging 0.87
IGL03199:Macc1 APN 12 119446421 missense probably benign 0.24
IGL03246:Macc1 APN 12 119446685 missense probably benign 0.00
IGL03265:Macc1 APN 12 119446976 missense probably benign 0.00
IGL03306:Macc1 APN 12 119446868 missense probably benign 0.00
IGL03307:Macc1 APN 12 119446420 missense probably benign
IGL03386:Macc1 APN 12 119445863 missense probably benign
PIT4366001:Macc1 UTSW 12 119446949 missense probably benign 0.01
PIT4431001:Macc1 UTSW 12 119446511 missense probably benign 0.00
R0033:Macc1 UTSW 12 119446341 missense probably benign 0.03
R0166:Macc1 UTSW 12 119447080 nonsense probably null
R0528:Macc1 UTSW 12 119447045 missense probably benign 0.09
R0688:Macc1 UTSW 12 119447003 missense probably damaging 0.96
R0725:Macc1 UTSW 12 119447516 nonsense probably null
R1356:Macc1 UTSW 12 119446555 missense probably benign 0.00
R1647:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1648:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1938:Macc1 UTSW 12 119445731 missense probably damaging 1.00
R2362:Macc1 UTSW 12 119447658 splice site probably benign
R2406:Macc1 UTSW 12 119465611 missense probably damaging 0.99
R3123:Macc1 UTSW 12 119447633 missense probably damaging 1.00
R3915:Macc1 UTSW 12 119446816 missense probably benign 0.13
R5256:Macc1 UTSW 12 119446529 missense possibly damaging 0.87
R5329:Macc1 UTSW 12 119446477 missense probably damaging 1.00
R5555:Macc1 UTSW 12 119450375 missense probably benign 0.24
R5992:Macc1 UTSW 12 119447585 missense probably damaging 0.96
R6024:Macc1 UTSW 12 119450425 missense probably benign 0.01
R6064:Macc1 UTSW 12 119445665 missense probably benign 0.14
R6196:Macc1 UTSW 12 119446050 missense probably damaging 1.00
R6697:Macc1 UTSW 12 119447256 missense possibly damaging 0.73
R7046:Macc1 UTSW 12 119447038 missense probably benign 0.02
R7060:Macc1 UTSW 12 119447455 missense probably damaging 1.00
R7094:Macc1 UTSW 12 119450391 nonsense probably null
R7120:Macc1 UTSW 12 119445745 missense possibly damaging 0.87
R7496:Macc1 UTSW 12 119446999 missense possibly damaging 0.56
R7534:Macc1 UTSW 12 119447519 missense probably benign 0.45
R7591:Macc1 UTSW 12 119446658 missense probably damaging 0.99
R7715:Macc1 UTSW 12 119446256 missense possibly damaging 0.72
R7823:Macc1 UTSW 12 119447065 missense probably damaging 0.98
R8121:Macc1 UTSW 12 119446589 missense probably damaging 0.97
R8157:Macc1 UTSW 12 119445993 missense probably benign 0.04
R8185:Macc1 UTSW 12 119447159 missense probably damaging 0.98
R8530:Macc1 UTSW 12 119445739 missense probably damaging 0.98
R8548:Macc1 UTSW 12 119450356 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTTTTCACTGTTTGTGGACACA -3'
(R):5'- ATCCTGGCAGATATGAGAACCTT -3'

Sequencing Primer
(F):5'- CAACTATGTGCCAGGAAAGTTTACAG -3'
(R):5'- CCTGGCAGATATGAGAACCTTTTTAG -3'
Posted On2015-01-23