Incidental Mutation 'R3713:Nol4'
ID259777
Institutional Source Beutler Lab
Gene Symbol Nol4
Ensembl Gene ENSMUSG00000041923
Gene Namenucleolar protein 4
Synonyms4930568N03Rik, 1700013J13Rik, LOC383304
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location22693181-23041653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23039937 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 36 (I36V)
Ref Sequence ENSEMBL: ENSMUSP00000130950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081423] [ENSMUST00000097651] [ENSMUST00000164186] [ENSMUST00000164893] [ENSMUST00000165323]
Predicted Effect probably benign
Transcript: ENSMUST00000081423
SMART Domains Protein: ENSMUSP00000080150
Gene: ENSMUSG00000041923

DomainStartEndE-ValueType
low complexity region 139 155 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 487 506 N/A INTRINSIC
low complexity region 513 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097651
AA Change: I36V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095256
Gene: ENSMUSG00000041923
AA Change: I36V

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164186
AA Change: I36V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130950
Gene: ENSMUSG00000041923
AA Change: I36V

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 560 579 N/A INTRINSIC
low complexity region 586 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164893
AA Change: I36V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127870
Gene: ENSMUSG00000041923
AA Change: I36V

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165323
SMART Domains Protein: ENSMUSP00000125860
Gene: ENSMUSG00000041923

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Nol4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Nol4 APN 18 22823412 missense probably benign 0.15
IGL00677:Nol4 APN 18 22921867 missense probably damaging 1.00
IGL01153:Nol4 APN 18 22769793 missense probably damaging 1.00
IGL01400:Nol4 APN 18 22823498 missense probably damaging 0.99
IGL02006:Nol4 APN 18 22921918 missense probably damaging 1.00
IGL02342:Nol4 APN 18 22770869 splice site probably benign
IGL02501:Nol4 APN 18 22823341 missense probably damaging 1.00
PIT4378001:Nol4 UTSW 18 23039876 missense probably damaging 1.00
R0096:Nol4 UTSW 18 22921858 missense possibly damaging 0.95
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R1257:Nol4 UTSW 18 22770681 missense probably damaging 1.00
R1793:Nol4 UTSW 18 22769821 missense probably damaging 1.00
R2101:Nol4 UTSW 18 22823409 missense probably damaging 1.00
R2357:Nol4 UTSW 18 23039910 missense probably benign 0.01
R2414:Nol4 UTSW 18 22823572 critical splice acceptor site probably null
R2427:Nol4 UTSW 18 22850698 intron probably benign
R3734:Nol4 UTSW 18 22770864 splice site probably benign
R3803:Nol4 UTSW 18 22694955 missense probably damaging 1.00
R4458:Nol4 UTSW 18 22751995 missense probably damaging 0.99
R4736:Nol4 UTSW 18 22718993 missense probably damaging 1.00
R4774:Nol4 UTSW 18 22912626 missense probably damaging 0.96
R4795:Nol4 UTSW 18 22921887 missense probably damaging 1.00
R5245:Nol4 UTSW 18 22695122 makesense probably null
R5980:Nol4 UTSW 18 22952201 missense probably damaging 0.97
R6372:Nol4 UTSW 18 23038556 critical splice donor site probably null
R6485:Nol4 UTSW 18 22770793 missense probably damaging 1.00
R6614:Nol4 UTSW 18 22920856 missense probably damaging 1.00
R6809:Nol4 UTSW 18 22920825 missense probably damaging 1.00
R6877:Nol4 UTSW 18 22719129 missense probably benign 0.06
R7269:Nol4 UTSW 18 23039789 missense probably benign
R7310:Nol4 UTSW 18 22770744 missense
R7720:Nol4 UTSW 18 23040023 missense probably benign 0.16
R7753:Nol4 UTSW 18 23038602 start codon destroyed probably benign 0.15
Z1088:Nol4 UTSW 18 22921902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAACTGTCTCCAGCATC -3'
(R):5'- TTTCATGAGACCAGGGTGAACAG -3'

Sequencing Primer
(F):5'- TTCCGGGCTGCTCCAACAG -3'
(R):5'- CCAGGGTGAACAGGTGCG -3'
Posted On2015-01-23