Incidental Mutation 'R3713:Prdx5'
ID259779
Institutional Source Beutler Lab
Gene Symbol Prdx5
Ensembl Gene ENSMUSG00000024953
Gene Nameperoxiredoxin 5
SynonymsAOPP, PMP20, Prdx6, PrxV, AOEB166, peroxiredoxin V, PrxV
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R3713 (G1)
Quality Score223
Status Validated
Chromosome19
Chromosomal Location6906697-6910106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6908109 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 56 (D56G)
Ref Sequence ENSEMBL: ENSMUSP00000025904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025904] [ENSMUST00000025906] [ENSMUST00000088257] [ENSMUST00000116551] [ENSMUST00000149261] [ENSMUST00000173091] [ENSMUST00000173635] [ENSMUST00000174786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025904
AA Change: D56G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025904
Gene: ENSMUSG00000024953
AA Change: D56G

DomainStartEndE-ValueType
Pfam:Redoxin 53 206 1e-31 PFAM
Pfam:AhpC-TSA 54 189 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025906
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088257
SMART Domains Protein: ENSMUSP00000085591
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116551
SMART Domains Protein: ENSMUSP00000112250
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145300
Predicted Effect possibly damaging
Transcript: ENSMUST00000149261
AA Change: D59G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135084
Gene: ENSMUSG00000024953
AA Change: D59G

DomainStartEndE-ValueType
Pfam:Redoxin 56 210 1.1e-31 PFAM
Pfam:AhpC-TSA 57 192 6.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172869
Predicted Effect probably damaging
Transcript: ENSMUST00000173091
AA Change: D56G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134521
Gene: ENSMUSG00000024953
AA Change: D56G

DomainStartEndE-ValueType
Pfam:Redoxin 53 99 3.3e-11 PFAM
Pfam:AhpC-TSA 54 100 9.3e-8 PFAM
Pfam:Redoxin 97 163 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173308
Predicted Effect probably benign
Transcript: ENSMUST00000173635
SMART Domains Protein: ENSMUSP00000134587
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
PDB:1LO1|A 1 21 6e-7 PDB
low complexity region 26 44 N/A INTRINSIC
Pfam:Hormone_recep 65 158 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174786
SMART Domains Protein: ENSMUSP00000134000
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 101 5.6e-11 PFAM
Meta Mutation Damage Score 0.7751 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. This protein interacts with peroxisome receptor 1. The crystal structure of this protein in its reduced form has been resolved to 1.5 angstrom resolution. This gene uses alternate in-frame translation initiation sites to generate mitochondrial or peroxisomal/cytoplasmic forms. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Prdx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Prdx5 APN 19 6909595 missense probably benign 0.06
R1601:Prdx5 UTSW 19 6907558 missense possibly damaging 0.56
R1886:Prdx5 UTSW 19 6908190 missense probably benign 0.26
R3849:Prdx5 UTSW 19 6906850 missense probably damaging 1.00
R4420:Prdx5 UTSW 19 6907964 splice site probably null
R4622:Prdx5 UTSW 19 6906973 unclassified probably benign
R7211:Prdx5 UTSW 19 6907590 missense probably damaging 1.00
R7423:Prdx5 UTSW 19 6910002 unclassified probably benign
R8338:Prdx5 UTSW 19 6907264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCGTCAATCAGAGCTATC -3'
(R):5'- GGCCTTAAGCAGAATCAGTCATG -3'

Sequencing Primer
(F):5'- CAGAGCTATCAGATTTAATGTGGG -3'
(R):5'- TTAAGCAGAATCAGTCATGTAGGATG -3'
Posted On2015-01-23