Incidental Mutation 'R3714:Ptprn'
ID 259780
Institutional Source Beutler Lab
Gene Symbol Ptprn
Ensembl Gene ENSMUSG00000026204
Gene Name protein tyrosine phosphatase, receptor type, N
Synonyms IA-2
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 75247027-75264502 bp(-) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 75252767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027404
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191154
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Ptprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Ptprn APN 1 75252270 missense probably damaging 0.99
IGL01900:Ptprn APN 1 75252248 splice site probably benign
IGL02189:Ptprn APN 1 75258495 missense possibly damaging 0.73
IGL02282:Ptprn APN 1 75253156 missense probably damaging 1.00
IGL02452:Ptprn APN 1 75258169 missense probably benign 0.34
IGL02865:Ptprn APN 1 75262363 missense probably damaging 1.00
IGL02926:Ptprn APN 1 75247873 missense possibly damaging 0.95
IGL03062:Ptprn APN 1 75247873 missense possibly damaging 0.95
ascorbic UTSW 1 75247893 missense probably benign 0.16
Delusion UTSW 1 75248166 missense probably damaging 1.00
H8562:Ptprn UTSW 1 75254620 missense possibly damaging 0.66
R0051:Ptprn UTSW 1 75252254 critical splice donor site probably null
R0107:Ptprn UTSW 1 75255712 missense probably damaging 0.99
R0801:Ptprn UTSW 1 75252265 missense probably damaging 1.00
R0865:Ptprn UTSW 1 75248138 splice site probably null
R1120:Ptprn UTSW 1 75258181 missense probably benign 0.00
R1534:Ptprn UTSW 1 75257943 critical splice donor site probably null
R1740:Ptprn UTSW 1 75262050 missense probably damaging 1.00
R1857:Ptprn UTSW 1 75247905 missense possibly damaging 0.64
R1927:Ptprn UTSW 1 75254122 missense probably benign 0.00
R1974:Ptprn UTSW 1 75254820 splice site probably null
R2071:Ptprn UTSW 1 75255144 missense probably damaging 1.00
R2223:Ptprn UTSW 1 75257937 unclassified probably benign
R4617:Ptprn UTSW 1 75252287 missense possibly damaging 0.74
R4832:Ptprn UTSW 1 75258265 missense probably benign 0.37
R5503:Ptprn UTSW 1 75251875 missense probably damaging 1.00
R5926:Ptprn UTSW 1 75254598 missense probably damaging 1.00
R6217:Ptprn UTSW 1 75248166 missense probably damaging 1.00
R6419:Ptprn UTSW 1 75264037 missense probably benign 0.10
R6793:Ptprn UTSW 1 75258142 missense probably benign 0.38
R6964:Ptprn UTSW 1 75260649 missense possibly damaging 0.83
R7071:Ptprn UTSW 1 75260619 missense possibly damaging 0.82
R7680:Ptprn UTSW 1 75247893 missense probably benign 0.16
R7777:Ptprn UTSW 1 75252302 missense possibly damaging 0.54
R7883:Ptprn UTSW 1 75262363 missense probably damaging 1.00
R8233:Ptprn UTSW 1 75253152 missense probably damaging 1.00
R8243:Ptprn UTSW 1 75252535 missense probably damaging 0.99
R8941:Ptprn UTSW 1 75251763 missense probably damaging 1.00
R9076:Ptprn UTSW 1 75252374 missense probably damaging 1.00
R9382:Ptprn UTSW 1 75252491 missense probably benign 0.05
X0017:Ptprn UTSW 1 75253265 missense probably benign 0.15
Z1088:Ptprn UTSW 1 75260620 missense possibly damaging 0.70
Z1176:Ptprn UTSW 1 75251818 missense probably damaging 0.99
Z1177:Ptprn UTSW 1 75258037 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGCTCGATCTAAGGGCAGAG -3'
(R):5'- TACCCTGTAAGCGAGTCGTG -3'

Sequencing Primer
(F):5'- CAGAGAGGATATGTCATGAGCC -3'
(R):5'- AGTCGTGGGCCAACTTG -3'
Posted On 2015-01-23