Mutagenetix > Incidental Mutation

Incidental Mutation 'R3714:Ptprn'

259780

Institutional Source

Beutler Lab

Gene Symbol

Ptprn

Ensembl Gene

ENSMUSG00000026204

Gene Name

protein tyrosine phosphatase, receptor type, N

Synonyms

IA-2

MMRRC Submission

040707-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.610) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75247027-75264502 bp(-) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

T to C at 75252767 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027404]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000027404

SMART Domains

Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
RESP18	63	164	1.5e-51	SMART
low complexity region	174	201	N/A	INTRINSIC
low complexity region	217	235	N/A	INTRINSIC
low complexity region	360	368	N/A	INTRINSIC
Pfam:Receptor_IA-2	471	559	7e-33	PFAM
transmembrane domain	579	601	N/A	INTRINSIC
low complexity region	650	679	N/A	INTRINSIC
PTPc	710	973	1.2e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187216

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191154

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Ptprn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01772:Ptprn	APN	1	75252270	missense	probably damaging	0.99
IGL01900:Ptprn	APN	1	75252248	splice site	probably benign
IGL02189:Ptprn	APN	1	75258495	missense	possibly damaging	0.73
IGL02282:Ptprn	APN	1	75253156	missense	probably damaging	1.00
IGL02452:Ptprn	APN	1	75258169	missense	probably benign	0.34
IGL02865:Ptprn	APN	1	75262363	missense	probably damaging	1.00
IGL02926:Ptprn	APN	1	75247873	missense	possibly damaging	0.95
IGL03062:Ptprn	APN	1	75247873	missense	possibly damaging	0.95
ascorbic	UTSW	1	75247893	missense	probably benign	0.16
Delusion	UTSW	1	75248166	missense	probably damaging	1.00
H8562:Ptprn	UTSW	1	75254620	missense	possibly damaging	0.66
R0051:Ptprn	UTSW	1	75252254	critical splice donor site	probably null
R0107:Ptprn	UTSW	1	75255712	missense	probably damaging	0.99
R0801:Ptprn	UTSW	1	75252265	missense	probably damaging	1.00
R0865:Ptprn	UTSW	1	75248138	splice site	probably null
R1120:Ptprn	UTSW	1	75258181	missense	probably benign	0.00
R1534:Ptprn	UTSW	1	75257943	critical splice donor site	probably null
R1740:Ptprn	UTSW	1	75262050	missense	probably damaging	1.00
R1857:Ptprn	UTSW	1	75247905	missense	possibly damaging	0.64
R1927:Ptprn	UTSW	1	75254122	missense	probably benign	0.00
R1974:Ptprn	UTSW	1	75254820	splice site	probably null
R2071:Ptprn	UTSW	1	75255144	missense	probably damaging	1.00
R2223:Ptprn	UTSW	1	75257937	unclassified	probably benign
R4617:Ptprn	UTSW	1	75252287	missense	possibly damaging	0.74
R4832:Ptprn	UTSW	1	75258265	missense	probably benign	0.37
R5503:Ptprn	UTSW	1	75251875	missense	probably damaging	1.00
R5926:Ptprn	UTSW	1	75254598	missense	probably damaging	1.00
R6217:Ptprn	UTSW	1	75248166	missense	probably damaging	1.00
R6419:Ptprn	UTSW	1	75264037	missense	probably benign	0.10
R6793:Ptprn	UTSW	1	75258142	missense	probably benign	0.38
R6964:Ptprn	UTSW	1	75260649	missense	possibly damaging	0.83
R7071:Ptprn	UTSW	1	75260619	missense	possibly damaging	0.82
R7680:Ptprn	UTSW	1	75247893	missense	probably benign	0.16
R7777:Ptprn	UTSW	1	75252302	missense	possibly damaging	0.54
R7883:Ptprn	UTSW	1	75262363	missense	probably damaging	1.00
R8233:Ptprn	UTSW	1	75253152	missense	probably damaging	1.00
R8243:Ptprn	UTSW	1	75252535	missense	probably damaging	0.99
R8941:Ptprn	UTSW	1	75251763	missense	probably damaging	1.00
R9076:Ptprn	UTSW	1	75252374	missense	probably damaging	1.00
R9382:Ptprn	UTSW	1	75252491	missense	probably benign	0.05
X0017:Ptprn	UTSW	1	75253265	missense	probably benign	0.15
Z1088:Ptprn	UTSW	1	75260620	missense	possibly damaging	0.70
Z1176:Ptprn	UTSW	1	75251818	missense	probably damaging	0.99
Z1177:Ptprn	UTSW	1	75258037	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATGCTCGATCTAAGGGCAGAG -3'
(R):5'- TACCCTGTAAGCGAGTCGTG -3'

Sequencing Primer
(F):5'- CAGAGAGGATATGTCATGAGCC -3'
(R):5'- AGTCGTGGGCCAACTTG -3'

Posted On

2015-01-23