Mutagenetix > Incidental Mutation

Incidental Mutation 'R3714:Atp1a2'

259781

Institutional Source

Beutler Lab

Gene Symbol

Atp1a2

Ensembl Gene

ENSMUSG00000007097

Gene Name

ATPase, Na+/K+ transporting, alpha 2 polypeptide

Synonyms

Atpa-3

MMRRC Submission

040707-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172271709-172298064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 172278984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 817 (I817T)

Ref Sequence

ENSEMBL: ENSMUSP00000095072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]

AlphaFold

Q6PIE5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085913
AA Change: I817T

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: I817T

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Cation_ATPase_N	40	114	5.28e-19	SMART
Pfam:E1-E2_ATPase	132	363	2.5e-59	PFAM
Pfam:Hydrolase	368	726	4.5e-19	PFAM
Pfam:HAD	371	723	3.2e-18	PFAM
Pfam:Cation_ATPase	424	518	1.9e-25	PFAM
Pfam:Cation_ATPase_C	796	1005	1.4e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097464
AA Change: I817T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: I817T

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Cation_ATPase_N	40	114	5.28e-19	SMART
Pfam:E1-E2_ATPase	133	364	1.9e-63	PFAM
Pfam:Hydrolase	368	726	2e-32	PFAM
Pfam:HAD	371	723	1.7e-15	PFAM
Pfam:Hydrolase_like2	424	518	1.3e-26	PFAM
Pfam:Cation_ATPase_C	796	947	3.2e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131751

Predicted Effect

probably benign
Transcript: ENSMUST00000139528

SMART Domains

Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

Domain	Start	End	E-Value	Type
IG_like	19	84	3.66e1	SMART
low complexity region	92	103	N/A	INTRINSIC
IG	106	222	2.3e-3	SMART
IG	246	370	9.49e-5	SMART
IG	382	508	3.59e-5	SMART
transmembrane domain	515	537	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191781

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Atp1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Atp1a2	APN	1	172276002	missense	probably damaging	1.00
IGL00954:Atp1a2	APN	1	172290634	missense	probably damaging	1.00
IGL01083:Atp1a2	APN	1	172284619	missense	probably benign
IGL01372:Atp1a2	APN	1	172278943	missense	probably damaging	1.00
IGL01762:Atp1a2	APN	1	172284913	missense	possibly damaging	0.89
IGL01896:Atp1a2	APN	1	172286011	missense	probably damaging	1.00
IGL01942:Atp1a2	APN	1	172286309	missense	probably benign	0.35
IGL01944:Atp1a2	APN	1	172276187	missense	probably damaging	0.98
IGL02219:Atp1a2	APN	1	172279718	missense	probably damaging	1.00
IGL02219:Atp1a2	APN	1	172279731	nonsense	probably null
IGL02304:Atp1a2	APN	1	172289353	missense	probably benign
IGL02507:Atp1a2	APN	1	172285771	missense	probably damaging	1.00
IGL02557:Atp1a2	APN	1	172278651	missense	possibly damaging	0.83
IGL02632:Atp1a2	APN	1	172280614	missense	possibly damaging	0.89
IGL03053:Atp1a2	APN	1	172278356	missense	probably damaging	1.00
IGL03104:Atp1a2	APN	1	172293367	missense	probably damaging	0.97
IGL03161:Atp1a2	APN	1	172278862	intron	probably benign
IGL03218:Atp1a2	APN	1	172289303	missense	probably null	0.82
PIT4151001:Atp1a2	UTSW	1	172290721	missense	probably damaging	0.99
PIT4520001:Atp1a2	UTSW	1	172279374	missense	probably benign	0.00
R0121:Atp1a2	UTSW	1	172289342	missense	probably damaging	0.99
R0630:Atp1a2	UTSW	1	172291275	missense	possibly damaging	0.78
R0682:Atp1a2	UTSW	1	172284597	missense	probably benign	0.00
R0755:Atp1a2	UTSW	1	172289381	missense	probably benign	0.37
R1413:Atp1a2	UTSW	1	172279344	missense	probably damaging	1.00
R1680:Atp1a2	UTSW	1	172278954	missense	probably damaging	0.99
R2094:Atp1a2	UTSW	1	172287433	missense	probably damaging	1.00
R4573:Atp1a2	UTSW	1	172278637	missense	possibly damaging	0.75
R4928:Atp1a2	UTSW	1	172278387	missense	possibly damaging	0.93
R4953:Atp1a2	UTSW	1	172291442	intron	probably benign
R5014:Atp1a2	UTSW	1	172284871	missense	probably benign	0.05
R5080:Atp1a2	UTSW	1	172284445	intron	probably benign
R5129:Atp1a2	UTSW	1	172275955	missense	probably benign	0.02
R5360:Atp1a2	UTSW	1	172278869	critical splice donor site	probably null
R5619:Atp1a2	UTSW	1	172279381	missense	probably damaging	0.99
R5622:Atp1a2	UTSW	1	172291427	intron	probably benign
R5718:Atp1a2	UTSW	1	172279442	missense	probably damaging	1.00
R5729:Atp1a2	UTSW	1	172293371	missense	probably damaging	0.99
R5909:Atp1a2	UTSW	1	172287230	missense	probably damaging	1.00
R6018:Atp1a2	UTSW	1	172298012	intron	probably benign
R6145:Atp1a2	UTSW	1	172287238	missense	probably damaging	1.00
R6164:Atp1a2	UTSW	1	172278892	missense	probably damaging	0.97
R6315:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6317:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6319:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6323:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6324:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6374:Atp1a2	UTSW	1	172289375	missense	probably damaging	1.00
R6764:Atp1a2	UTSW	1	172284614	missense	probably benign
R6812:Atp1a2	UTSW	1	172284877	missense	probably benign	0.20
R7025:Atp1a2	UTSW	1	172284550	nonsense	probably null
R7194:Atp1a2	UTSW	1	172280627	nonsense	probably null
R7459:Atp1a2	UTSW	1	172287295	missense	probably benign	0.00
R7791:Atp1a2	UTSW	1	172276215	missense	probably benign	0.28
R7889:Atp1a2	UTSW	1	172278064	splice site	probably null
R7993:Atp1a2	UTSW	1	172291311	missense	possibly damaging	0.86
R8183:Atp1a2	UTSW	1	172289351	missense	probably damaging	0.96
R8434:Atp1a2	UTSW	1	172284612	missense	probably benign	0.01
R8712:Atp1a2	UTSW	1	172275980	missense	probably benign	0.05
R8724:Atp1a2	UTSW	1	172279378	missense	probably benign	0.13
R8887:Atp1a2	UTSW	1	172285655	missense	probably null	0.02
R8965:Atp1a2	UTSW	1	172280045	missense	probably benign	0.25
R9322:Atp1a2	UTSW	1	172280058	missense	possibly damaging	0.94
R9383:Atp1a2	UTSW	1	172279767	missense	probably benign
R9451:Atp1a2	UTSW	1	172275927	missense	probably benign
R9485:Atp1a2	UTSW	1	172278255	makesense	probably null
R9727:Atp1a2	UTSW	1	172291369	missense	probably benign	0.01
Z1176:Atp1a2	UTSW	1	172279754	missense	possibly damaging	0.90
Z1177:Atp1a2	UTSW	1	172287336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCGGGAACTAGAAGCAACC -3'
(R):5'- CTAGACAGCAGATCAGCACAGG -3'

Sequencing Primer
(F):5'- CTCGGGAACTAGAAGCAACCTTTAG -3'
(R):5'- CACCATACTCTAGTACTGGGGATTG -3'

Posted On

2015-01-23