Incidental Mutation 'R3714:Tmem63a'
ID 259782
Institutional Source Beutler Lab
Gene Symbol Tmem63a
Ensembl Gene ENSMUSG00000026519
Gene Name transmembrane protein 63a
Synonyms
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 180942344-180975112 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 180963114 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 446 (D446N)
Ref Sequence ENSEMBL: ENSMUSP00000124021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000161523]
AlphaFold Q91YT8
Predicted Effect possibly damaging
Transcript: ENSMUST00000027800
AA Change: D446N

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519
AA Change: D446N

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128545
Predicted Effect possibly damaging
Transcript: ENSMUST00000161523
AA Change: D446N

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124021
Gene: ENSMUSG00000026519
AA Change: D446N

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.6e-25 PFAM
Pfam:DUF4463 261 326 9.4e-15 PFAM
Pfam:DUF221 349 692 1.4e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161942
Meta Mutation Damage Score 0.6253 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Tmem63a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Tmem63a APN 1 180963088 missense probably damaging 1.00
IGL00331:Tmem63a APN 1 180966497 missense possibly damaging 0.46
IGL01116:Tmem63a APN 1 180972089 missense probably damaging 0.96
IGL01368:Tmem63a APN 1 180970232 missense possibly damaging 0.69
IGL01445:Tmem63a APN 1 180946631 missense probably damaging 1.00
IGL01867:Tmem63a APN 1 180956005 missense possibly damaging 0.87
IGL02043:Tmem63a APN 1 180972788 missense probably benign 0.11
IGL02453:Tmem63a APN 1 180963069 missense probably benign 0.02
IGL02527:Tmem63a APN 1 180952974 splice site probably null
IGL02811:Tmem63a APN 1 180965783 missense probably damaging 0.99
IGL02975:Tmem63a APN 1 180961075 missense probably benign
IGL03304:Tmem63a APN 1 180968853 nonsense probably null
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0173:Tmem63a UTSW 1 180954798 splice site probably benign
R0358:Tmem63a UTSW 1 180956423 missense probably benign 0.17
R0436:Tmem63a UTSW 1 180972733 missense probably benign 0.03
R0506:Tmem63a UTSW 1 180958049 critical splice donor site probably null
R0513:Tmem63a UTSW 1 180960461 missense probably benign 0.00
R0529:Tmem63a UTSW 1 180961094 missense probably benign 0.09
R0855:Tmem63a UTSW 1 180961060 missense possibly damaging 0.82
R1633:Tmem63a UTSW 1 180948826 missense probably damaging 0.98
R2129:Tmem63a UTSW 1 180965540 missense probably benign 0.00
R2212:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R2214:Tmem63a UTSW 1 180961114 missense probably benign 0.00
R2413:Tmem63a UTSW 1 180961075 missense probably benign
R2437:Tmem63a UTSW 1 180962489 splice site probably null
R3703:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3704:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3705:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3746:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3747:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3961:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3963:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R4675:Tmem63a UTSW 1 180956491 missense probably benign 0.00
R4795:Tmem63a UTSW 1 180954851 missense probably damaging 1.00
R4876:Tmem63a UTSW 1 180973186 missense probably benign
R4916:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4917:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4918:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R5620:Tmem63a UTSW 1 180970246 missense probably benign 0.00
R5843:Tmem63a UTSW 1 180972833 critical splice donor site probably null
R5937:Tmem63a UTSW 1 180961151 missense probably damaging 1.00
R6823:Tmem63a UTSW 1 180960470 missense possibly damaging 0.60
R6990:Tmem63a UTSW 1 180961121 missense probably benign 0.02
R7075:Tmem63a UTSW 1 180961149 missense probably damaging 1.00
R7129:Tmem63a UTSW 1 180954876 missense probably damaging 0.98
R7447:Tmem63a UTSW 1 180958023 missense probably benign 0.04
R7609:Tmem63a UTSW 1 180952974 splice site probably null
R8116:Tmem63a UTSW 1 180960483 missense probably benign 0.04
R8141:Tmem63a UTSW 1 180974211 missense probably benign 0.06
R8296:Tmem63a UTSW 1 180961120 missense probably benign 0.36
R8770:Tmem63a UTSW 1 180962396 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGGATGTCCATGTCTGAGAGAC -3'
(R):5'- GCCTGCTTTCAGCTTAAAAGG -3'

Sequencing Primer
(F):5'- AGAGACTAAGCCTCTCTCTCGG -3'
(R):5'- TGCTGTGCAAGTATGAAATCCCC -3'
Posted On 2015-01-23