Incidental Mutation 'R3714:Olfr1240'
ID 259783
Institutional Source Beutler Lab
Gene Symbol Olfr1240
Ensembl Gene ENSMUSG00000111174
Gene Name olfactory receptor 1240
Synonyms MOR231-8, GA_x6K02T2Q125-50883183-50882239
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89436296-89443000 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89439383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 299 (L299F)
Ref Sequence ENSEMBL: ENSMUSP00000150256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215362] [ENSMUST00000216123]
AlphaFold Q8VG73
Predicted Effect probably damaging
Transcript: ENSMUST00000099779
AA Change: L299F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097367
Gene: ENSMUSG00000075087
AA Change: L299F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4e-45 PFAM
Pfam:7tm_1 39 285 1.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187363
AA Change: L299F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139968
Gene: ENSMUSG00000099909
AA Change: L299F

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2e-28 PFAM
Pfam:7tm_4 137 278 1.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215362
AA Change: L299F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216123
AA Change: L299F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Olfr1240
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr1240 APN 2 89439800 missense probably benign 0.00
IGL01767:Olfr1240 APN 2 89439800 missense probably benign 0.00
R0375:Olfr1240 UTSW 2 89439396 missense probably benign 0.00
R0417:Olfr1240 UTSW 2 89440175 missense possibly damaging 0.88
R0501:Olfr1240 UTSW 2 89439716 missense probably benign 0.09
R0586:Olfr1240 UTSW 2 89439354 missense possibly damaging 0.55
R0624:Olfr1240 UTSW 2 89440138 missense possibly damaging 0.94
R1168:Olfr1240 UTSW 2 89439869 nonsense probably null
R1728:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1729:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1730:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1739:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1762:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1783:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1785:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2038:Olfr1240 UTSW 2 89439345 missense probably benign 0.00
R2049:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2069:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2140:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2142:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2215:Olfr1240 UTSW 2 89440037 missense probably benign 0.00
R4304:Olfr1240 UTSW 2 89440198 missense probably damaging 0.96
R4437:Olfr1240 UTSW 2 89439354 missense possibly damaging 0.55
R4825:Olfr1240 UTSW 2 89439865 missense probably benign 0.01
R4857:Olfr1240 UTSW 2 89439623 missense probably damaging 1.00
R4865:Olfr1240 UTSW 2 89439659 missense possibly damaging 0.88
R5588:Olfr1240 UTSW 2 89439416 missense probably damaging 1.00
R5730:Olfr1240 UTSW 2 89439436 missense probably damaging 1.00
R7206:Olfr1240 UTSW 2 89440457 start gained probably benign
R7365:Olfr1240 UTSW 2 89440198 missense probably benign 0.01
R7574:Olfr1240 UTSW 2 89439401 missense possibly damaging 0.94
R8007:Olfr1240 UTSW 2 89440340
R8268:Olfr1240 UTSW 2 89439436 missense probably damaging 1.00
R8559:Olfr1240 UTSW 2 89440184 missense probably benign 0.03
R8812:Olfr1240 UTSW 2 89439865 missense probably benign 0.01
R9269:Olfr1240 UTSW 2 89439932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATCCCCAAACTGAGCAGG -3'
(R):5'- GCAGCTCCCACATCATAGTG -3'

Sequencing Primer
(F):5'- GCAGGTATAAAAATCTGCCATGC -3'
(R):5'- TGTTAGACCTGTCTCCAAC -3'
Posted On 2015-01-23