Mutagenetix > Incidental Mutation

Incidental Mutation 'R3714:Haus6'

259787

Institutional Source

Beutler Lab

Gene Symbol

Haus6

Ensembl Gene

ENSMUSG00000038047

Gene Name

HAUS augmin-like complex, subunit 6

Synonyms

6230416J20Rik, D4Ertd27e

MMRRC Submission

040707-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.671) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86578855-86612055 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86602867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 178 (I178T)

Ref Sequence

ENSEMBL: ENSMUSP00000070504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070607] [ENSMUST00000125481]

AlphaFold

Q6NV99

Predicted Effect

probably benign
Transcript: ENSMUST00000070607
AA Change: I178T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: I178T

Domain	Start	End	E-Value	Type
Pfam:HAUS6_N	14	238	1.1e-77	PFAM
low complexity region	613	624	N/A	INTRINSIC
low complexity region	771	785	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123432

Predicted Effect

probably benign
Transcript: ENSMUST00000125481

SMART Domains

Protein: ENSMUSP00000118609
Gene: ENSMUSG00000038047

Domain	Start	End	E-Value	Type
Pfam:HAUS6_N	43	69	2.3e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128381

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Haus6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Haus6	APN	4	86607981	missense	probably benign	0.32
IGL02307:Haus6	APN	4	86583835	missense	possibly damaging	0.53
IGL03113:Haus6	APN	4	86583106	nonsense	probably null
IGL03384:Haus6	APN	4	86583525	missense	probably benign
R0436:Haus6	UTSW	4	86585807	missense	probably benign	0.00
R0491:Haus6	UTSW	4	86602846	missense	possibly damaging	0.93
R0620:Haus6	UTSW	4	86583514	missense	possibly damaging	0.53
R1118:Haus6	UTSW	4	86585326	critical splice donor site	probably null
R1969:Haus6	UTSW	4	86604246	missense	probably damaging	0.99
R1985:Haus6	UTSW	4	86593609	missense	possibly damaging	0.96
R2213:Haus6	UTSW	4	86581992	missense	possibly damaging	0.53
R2448:Haus6	UTSW	4	86589001	missense	possibly damaging	0.53
R2567:Haus6	UTSW	4	86585885	nonsense	probably null
R2760:Haus6	UTSW	4	86583176	nonsense	probably null
R3962:Haus6	UTSW	4	86611804	missense	possibly damaging	0.85
R4180:Haus6	UTSW	4	86583574	missense	probably benign	0.00
R4736:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4738:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4929:Haus6	UTSW	4	86595433	missense	probably benign	0.03
R4933:Haus6	UTSW	4	86585287	intron	probably benign
R5027:Haus6	UTSW	4	86605696	missense	possibly damaging	0.92
R5199:Haus6	UTSW	4	86582985	missense	possibly damaging	0.85
R5240:Haus6	UTSW	4	86583178	missense	possibly damaging	0.86
R5580:Haus6	UTSW	4	86599266	missense	possibly damaging	0.73
R5781:Haus6	UTSW	4	86601263	missense	possibly damaging	0.92
R5865:Haus6	UTSW	4	86586357	missense	possibly damaging	0.73
R5926:Haus6	UTSW	4	86599316	missense	probably benign
R6154:Haus6	UTSW	4	86583756	missense	possibly damaging	0.96
R7166:Haus6	UTSW	4	86583687	missense	possibly damaging	0.72
R7183:Haus6	UTSW	4	86583752	missense	possibly damaging	0.53
R7418:Haus6	UTSW	4	86594773	missense	possibly damaging	0.73
R7843:Haus6	UTSW	4	86586341	missense	possibly damaging	0.85
R8893:Haus6	UTSW	4	86583127	missense	possibly damaging	0.73
R9386:Haus6	UTSW	4	86583864	missense	probably benign	0.33
R9449:Haus6	UTSW	4	86595428	missense	probably benign	0.00
Z1088:Haus6	UTSW	4	86602874	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- ACTACAATCAGGACAATTAGAATCCA -3'
(R):5'- AACAAAGTGAAGAGTTGCTTGAA -3'

Sequencing Primer
(F):5'- GTGGCTCACAACTGTCTGTAAC -3'
(R):5'- GACAAGCTCATGGTGACA -3'

Posted On

2015-01-23