Incidental Mutation 'R3714:Ddx47'
ID 259789
Institutional Source Beutler Lab
Gene Symbol Ddx47
Ensembl Gene ENSMUSG00000030204
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Synonyms
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 135011612-135023776 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 135019062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 329 (I329K)
Ref Sequence ENSEMBL: ENSMUSP00000032326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032326] [ENSMUST00000130851] [ENSMUST00000205055] [ENSMUST00000205244]
AlphaFold Q9CWX9
Predicted Effect probably damaging
Transcript: ENSMUST00000032326
AA Change: I329K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032326
Gene: ENSMUSG00000030204
AA Change: I329K

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 241 6.38e-61 SMART
HELICc 277 358 8.21e-32 SMART
low complexity region 413 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123022
Predicted Effect probably benign
Transcript: ENSMUST00000130851
SMART Domains Protein: ENSMUSP00000115183
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
Blast:DEXDc 30 59 9e-12 BLAST
Pfam:Helicase_C 99 138 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134549
Predicted Effect unknown
Transcript: ENSMUST00000154558
AA Change: I276K
SMART Domains Protein: ENSMUSP00000119231
Gene: ENSMUSG00000030204
AA Change: I276K

DomainStartEndE-ValueType
low complexity region 13 20 N/A INTRINSIC
DEXDc 40 238 6.38e-61 SMART
HELICc 229 306 3.67e-20 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155022
AA Change: I21K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155698
Predicted Effect unknown
Transcript: ENSMUST00000204646
AA Change: I304K
Predicted Effect probably benign
Transcript: ENSMUST00000205055
SMART Domains Protein: ENSMUSP00000145463
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 178 1.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205244
SMART Domains Protein: ENSMUSP00000145139
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
DEXDc 6 178 3e-15 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Ddx47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02719:Ddx47 APN 6 135017151 missense probably benign 0.06
PIT4466001:Ddx47 UTSW 6 135015840 missense probably benign 0.31
R0304:Ddx47 UTSW 6 135017220 missense possibly damaging 0.62
R0617:Ddx47 UTSW 6 135017122 missense probably damaging 1.00
R1223:Ddx47 UTSW 6 135012314 missense possibly damaging 0.70
R1468:Ddx47 UTSW 6 135011740 splice site probably benign
R2005:Ddx47 UTSW 6 135018121 missense probably benign 0.06
R2134:Ddx47 UTSW 6 135015350 nonsense probably null
R2993:Ddx47 UTSW 6 135018981 missense probably damaging 1.00
R4352:Ddx47 UTSW 6 135018055 missense probably benign 0.38
R4355:Ddx47 UTSW 6 135021505 missense probably benign
R4495:Ddx47 UTSW 6 135021466 missense possibly damaging 0.62
R4664:Ddx47 UTSW 6 135012356 missense possibly damaging 0.95
R5527:Ddx47 UTSW 6 135011694 missense probably benign 0.35
R6119:Ddx47 UTSW 6 135023355 missense probably benign
R7038:Ddx47 UTSW 6 135023373 missense possibly damaging 0.84
R7270:Ddx47 UTSW 6 135023338 missense probably benign 0.08
R8855:Ddx47 UTSW 6 135023393 missense probably benign 0.06
R8866:Ddx47 UTSW 6 135023393 missense probably benign 0.06
X0026:Ddx47 UTSW 6 135023389 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTGACTATGAAGCCCCAGCC -3'
(R):5'- AAGAGCTTTCTCAGTTGTTGCTAG -3'

Sequencing Primer
(F):5'- CCAGCCTGGACTTAGAAGGG -3'
(R):5'- CAGTTTACTGGTGCTACAGCTCAAG -3'
Posted On 2015-01-23