Incidental Mutation 'R3714:Nlrp4b'
ID 259790
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene Name NLR family, pyrin domain containing 4B
Synonyms Nalp4b, Nalp-gamma
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 10687789-10730168 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10714881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 337 (V337A)
Ref Sequence ENSEMBL: ENSMUSP00000113095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
AlphaFold Q8C6J9
Predicted Effect probably benign
Transcript: ENSMUST00000047809
AA Change: V337A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: V337A

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117413
AA Change: V337A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: V337A

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211772
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0564:Nlrp4b UTSW 7 10714658 missense probably benign 0.15
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R2904:Nlrp4b UTSW 7 10714367 missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10715245 nonsense probably null
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10710370 missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
R7537:Nlrp4b UTSW 7 10714889 missense probably benign 0.05
R7793:Nlrp4b UTSW 7 10725074 missense probably benign 0.00
R8138:Nlrp4b UTSW 7 10715531 missense probably benign 0.01
R8190:Nlrp4b UTSW 7 10714392 missense probably damaging 0.96
R8326:Nlrp4b UTSW 7 10718544 missense probably benign 0.05
R8353:Nlrp4b UTSW 7 10715601 missense probably damaging 0.99
R8417:Nlrp4b UTSW 7 10725953 nonsense probably null
R8453:Nlrp4b UTSW 7 10715601 missense probably damaging 0.99
R8998:Nlrp4b UTSW 7 10715702 missense probably null 0.00
R9002:Nlrp4b UTSW 7 10714959 missense probably damaging 1.00
R9072:Nlrp4b UTSW 7 10725943 missense probably benign 0.02
R9073:Nlrp4b UTSW 7 10725943 missense probably benign 0.02
R9258:Nlrp4b UTSW 7 10710160 missense probably damaging 1.00
R9373:Nlrp4b UTSW 7 10715199 missense probably benign 0.01
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTCAGGAAGAAGATACTCCCTG -3'
(R):5'- GTTATCCAGCAGGTCTTCGC -3'

Sequencing Primer
(F):5'- GGAAGAAGATACTCCCTGAATCATC -3'
(R):5'- ATCCAGCAGGTCTTCGCTATTG -3'
Posted On 2015-01-23