Incidental Mutation 'R3714:Cers3'
ID 259791
Institutional Source Beutler Lab
Gene Symbol Cers3
Ensembl Gene ENSMUSG00000030510
Gene Name ceramide synthase 3
Synonyms related to TRH3, Lass3, T3L, CerS3, 4930550L11Rik, LOC233330
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 66743504-66823691 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 66786075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 261 (A261S)
Ref Sequence ENSEMBL: ENSMUSP00000069238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066475] [ENSMUST00000208521]
AlphaFold Q1A3B0
Predicted Effect probably benign
Transcript: ENSMUST00000066475
AA Change: A261S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: A261S

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
HOX 110 167 2.48e-2 SMART
TLC 166 367 6.52e-57 SMART
low complexity region 379 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208521
AA Change: A225S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Cers3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Cers3 APN 7 66786003 splice site probably benign
IGL02832:Cers3 APN 7 66781825 missense probably benign 0.00
R0400:Cers3 UTSW 7 66764330 missense probably benign 0.03
R0490:Cers3 UTSW 7 66773690 missense possibly damaging 0.69
R0558:Cers3 UTSW 7 66783418 missense probably damaging 1.00
R0571:Cers3 UTSW 7 66786057 missense possibly damaging 0.93
R1452:Cers3 UTSW 7 66783404 missense probably damaging 1.00
R1538:Cers3 UTSW 7 66781823 missense probably damaging 0.98
R1767:Cers3 UTSW 7 66783403 missense probably damaging 1.00
R2155:Cers3 UTSW 7 66783414 missense probably damaging 0.99
R2427:Cers3 UTSW 7 66795793 missense probably benign 0.04
R3705:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3713:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3715:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3961:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3963:Cers3 UTSW 7 66786075 missense probably benign 0.25
R4238:Cers3 UTSW 7 66773676 missense probably damaging 1.00
R4652:Cers3 UTSW 7 66781856 splice site probably null
R5174:Cers3 UTSW 7 66784868 missense probably damaging 1.00
R6493:Cers3 UTSW 7 66743720 missense probably benign 0.07
R6675:Cers3 UTSW 7 66786096 missense possibly damaging 0.50
R6807:Cers3 UTSW 7 66764220 missense probably damaging 1.00
R6833:Cers3 UTSW 7 66779671 critical splice donor site probably null
R7223:Cers3 UTSW 7 66783415 missense probably damaging 0.99
R7592:Cers3 UTSW 7 66789629 missense probably damaging 1.00
R7835:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
R8202:Cers3 UTSW 7 66786013 missense probably damaging 0.99
R8322:Cers3 UTSW 7 66789638 missense probably damaging 1.00
R8350:Cers3 UTSW 7 66764342 missense possibly damaging 0.54
R8450:Cers3 UTSW 7 66764342 missense possibly damaging 0.54
R8757:Cers3 UTSW 7 66786102 missense probably damaging 1.00
R8759:Cers3 UTSW 7 66786102 missense probably damaging 1.00
R9149:Cers3 UTSW 7 66743694 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAAGTGTTAGGTGCTGTCTCAG -3'
(R):5'- GACAGAGTGCCCTTCCAAATC -3'

Sequencing Primer
(F):5'- TCAATAAGGGTGACACTTGCCCTG -3'
(R):5'- GAGTGCCCTTCCAAATCACTCAC -3'
Posted On 2015-01-23