Incidental Mutation 'R3714:Lcmt1'
ID 259793
Institutional Source Beutler Lab
Gene Symbol Lcmt1
Ensembl Gene ENSMUSG00000030763
Gene Name leucine carboxyl methyltransferase 1
Synonyms LCMT-1, Lcmt
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 123369784-123430358 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123404460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 146 (H146Y)
Ref Sequence ENSEMBL: ENSMUSP00000145539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033025] [ENSMUST00000206574] [ENSMUST00000206721]
AlphaFold A0A0U1RNF2
Predicted Effect possibly damaging
Transcript: ENSMUST00000033025
AA Change: H146Y

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033025
Gene: ENSMUSG00000030763
AA Change: H146Y

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:LCM 23 215 3.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205880
Predicted Effect probably damaging
Transcript: ENSMUST00000206574
AA Change: H146Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000206721
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Lcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Lcmt1 APN 7 123428153 missense probably damaging 1.00
IGL01536:Lcmt1 APN 7 123422743 missense possibly damaging 0.46
IGL01564:Lcmt1 APN 7 123404440 missense probably benign 0.00
IGL02598:Lcmt1 APN 7 123421648 splice site probably benign
rancho UTSW 7 123401495 missense probably benign 0.03
relasso UTSW 7 123401468 missense probably damaging 1.00
R0665:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0668:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0943:Lcmt1 UTSW 7 123401439 splice site probably null
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R2896:Lcmt1 UTSW 7 123421586 missense possibly damaging 0.95
R3017:Lcmt1 UTSW 7 123430136 missense probably damaging 1.00
R3547:Lcmt1 UTSW 7 123400479 missense probably benign 0.07
R4092:Lcmt1 UTSW 7 123418253 missense probably damaging 1.00
R4628:Lcmt1 UTSW 7 123410812 nonsense probably null
R5062:Lcmt1 UTSW 7 123410830 splice site probably null
R5096:Lcmt1 UTSW 7 123401468 missense probably damaging 1.00
R5549:Lcmt1 UTSW 7 123428107 missense probably damaging 1.00
R5573:Lcmt1 UTSW 7 123401463 missense probably benign 0.03
R5931:Lcmt1 UTSW 7 123421616 missense probably benign
R6331:Lcmt1 UTSW 7 123378182 intron probably benign
R7752:Lcmt1 UTSW 7 123369807 missense unknown
R7784:Lcmt1 UTSW 7 123401495 missense probably benign 0.03
R8447:Lcmt1 UTSW 7 123421602 missense probably damaging 1.00
R8499:Lcmt1 UTSW 7 123430148 missense probably benign 0.02
R8743:Lcmt1 UTSW 7 123400468 missense probably damaging 1.00
R8962:Lcmt1 UTSW 7 123401446 missense probably damaging 1.00
RF013:Lcmt1 UTSW 7 123369836 frame shift probably null
RF025:Lcmt1 UTSW 7 123369834 frame shift probably null
RF046:Lcmt1 UTSW 7 123369834 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGTTAGGGACGTGTAATGG -3'
(R):5'- ATGGCTAAGTGGTAACGGGC -3'

Sequencing Primer
(F):5'- ACGTGTAATGGTAATGTCTATGCAG -3'
(R):5'- CATGTAGAAGATCCTAGGTGACGGC -3'
Posted On 2015-01-23