Mutagenetix > Incidental Mutations

Incidental Mutation 'R3714:Jrkl'

259798

Institutional Source

Beutler Lab

Gene Symbol

Jrkl

Ensembl Gene

ENSMUSG00000079083

Gene Name

Jrk-like

Synonyms

C030035D04Rik

MMRRC Submission

040707-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13242607-13245829 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 13244231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Arginine at position 475 (I475R)

Ref Sequence

ENSEMBL: ENSMUSP00000128798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110582] [ENSMUST00000110583] [ENSMUST00000217444]

AlphaFold

B2RRL2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110582
AA Change: I475R

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000128798
Gene: ENSMUSG00000079083
AA Change: I475R

Domain	Start	End	E-Value	Type
Pfam:CENP-B_N	4	54	6e-18	PFAM
CENPB	73	139	1.45e-24	SMART
Pfam:DDE_1	206	385	1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110583

SMART Domains

Protein: ENSMUSP00000106212
Gene: ENSMUSG00000079084

Domain	Start	End	E-Value	Type
low complexity region	38	70	N/A	INTRINSIC
Pfam:DUF4196	98	211	1.8e-50	PFAM
low complexity region	218	231	N/A	INTRINSIC
Pfam:DUF4211	273	432	1e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169961

SMART Domains

Protein: ENSMUSP00000126058
Gene: ENSMUSG00000079084

Domain	Start	End	E-Value	Type
low complexity region	38	70	N/A	INTRINSIC
Pfam:DUF4196	98	211	2.2e-55	PFAM
low complexity region	218	231	N/A	INTRINSIC
low complexity region	250	273	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215735

Predicted Effect

probably benign
Transcript: ENSMUST00000217444

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been defined, however, the encoded protein shares similarity with the human (41% identical) and mouse (34% identical) jerky gene products. This protein may act as a nuclear regulatory protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Jrkl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB007:Jrkl	UTSW	9	13245501	missense	possibly damaging	0.95
BB017:Jrkl	UTSW	9	13245501	missense	possibly damaging	0.95
R1185:Jrkl	UTSW	9	13244933	missense	possibly damaging	0.69
R1185:Jrkl	UTSW	9	13244933	missense	possibly damaging	0.69
R1185:Jrkl	UTSW	9	13244933	missense	possibly damaging	0.69
R1432:Jrkl	UTSW	9	13245332	missense	probably benign	0.15
R1914:Jrkl	UTSW	9	13245604	missense	possibly damaging	0.48
R1915:Jrkl	UTSW	9	13245604	missense	possibly damaging	0.48
R2079:Jrkl	UTSW	9	13244859	missense	probably damaging	1.00
R2155:Jrkl	UTSW	9	13244908	nonsense	probably null
R3734:Jrkl	UTSW	9	13245530	missense	possibly damaging	0.95
R4394:Jrkl	UTSW	9	13245141	nonsense	probably null
R4486:Jrkl	UTSW	9	13245371	missense	probably benign	0.36
R5687:Jrkl	UTSW	9	13244382	missense	probably benign	0.07
R5724:Jrkl	UTSW	9	13244886	missense	possibly damaging	0.68
R6394:Jrkl	UTSW	9	13245490	nonsense	probably null
R7002:Jrkl	UTSW	9	13245521	missense	probably damaging	1.00
R7196:Jrkl	UTSW	9	13244157	missense	probably benign	0.03
R7851:Jrkl	UTSW	9	13244349	missense	probably benign	0.03
R7930:Jrkl	UTSW	9	13245501	missense	possibly damaging	0.95
R8864:Jrkl	UTSW	9	13244321	missense	probably benign	0.06
R9062:Jrkl	UTSW	9	13245333	missense	probably benign	0.06
R9163:Jrkl	UTSW	9	13245399	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTAAGGAATGCCACTCCTAG -3'
(R):5'- AGGACTGGAAAATGTGACTCC -3'

Sequencing Primer
(F):5'- GTAAGGAATGCCACTCCTAGAGATC -3'
(R):5'- CTCCTGAAAATTTGGAAAAGTGGC -3'

Posted On

2015-01-23