Incidental Mutation 'R3714:Jrkl'
ID 259798
Institutional Source Beutler Lab
Gene Symbol Jrkl
Ensembl Gene ENSMUSG00000079083
Gene Name Jrk-like
Synonyms C030035D04Rik
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 13242607-13245829 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 13244231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 475 (I475R)
Ref Sequence ENSEMBL: ENSMUSP00000128798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110582] [ENSMUST00000110583] [ENSMUST00000217444]
AlphaFold B2RRL2
Predicted Effect possibly damaging
Transcript: ENSMUST00000110582
AA Change: I475R

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128798
Gene: ENSMUSG00000079083
AA Change: I475R

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-18 PFAM
CENPB 73 139 1.45e-24 SMART
Pfam:DDE_1 206 385 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110583
SMART Domains Protein: ENSMUSP00000106212
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 1.8e-50 PFAM
low complexity region 218 231 N/A INTRINSIC
Pfam:DUF4211 273 432 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169961
SMART Domains Protein: ENSMUSP00000126058
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 2.2e-55 PFAM
low complexity region 218 231 N/A INTRINSIC
low complexity region 250 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215735
Predicted Effect probably benign
Transcript: ENSMUST00000217444
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been defined, however, the encoded protein shares similarity with the human (41% identical) and mouse (34% identical) jerky gene products. This protein may act as a nuclear regulatory protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Jrkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Jrkl UTSW 9 13245501 missense possibly damaging 0.95
BB017:Jrkl UTSW 9 13245501 missense possibly damaging 0.95
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1432:Jrkl UTSW 9 13245332 missense probably benign 0.15
R1914:Jrkl UTSW 9 13245604 missense possibly damaging 0.48
R1915:Jrkl UTSW 9 13245604 missense possibly damaging 0.48
R2079:Jrkl UTSW 9 13244859 missense probably damaging 1.00
R2155:Jrkl UTSW 9 13244908 nonsense probably null
R3734:Jrkl UTSW 9 13245530 missense possibly damaging 0.95
R4394:Jrkl UTSW 9 13245141 nonsense probably null
R4486:Jrkl UTSW 9 13245371 missense probably benign 0.36
R5687:Jrkl UTSW 9 13244382 missense probably benign 0.07
R5724:Jrkl UTSW 9 13244886 missense possibly damaging 0.68
R6394:Jrkl UTSW 9 13245490 nonsense probably null
R7002:Jrkl UTSW 9 13245521 missense probably damaging 1.00
R7196:Jrkl UTSW 9 13244157 missense probably benign 0.03
R7851:Jrkl UTSW 9 13244349 missense probably benign 0.03
R7930:Jrkl UTSW 9 13245501 missense possibly damaging 0.95
R8864:Jrkl UTSW 9 13244321 missense probably benign 0.06
R9062:Jrkl UTSW 9 13245333 missense probably benign 0.06
R9163:Jrkl UTSW 9 13245399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTAAGGAATGCCACTCCTAG -3'
(R):5'- AGGACTGGAAAATGTGACTCC -3'

Sequencing Primer
(F):5'- GTAAGGAATGCCACTCCTAGAGATC -3'
(R):5'- CTCCTGAAAATTTGGAAAAGTGGC -3'
Posted On 2015-01-23