Incidental Mutation 'R3714:Elavl3'
ID 259800
Institutional Source Beutler Lab
Gene Symbol Elavl3
Ensembl Gene ENSMUSG00000003410
Gene Name ELAV like RNA binding protein 3
Synonyms 2600009P04Rik, Huc, mHuC
MMRRC Submission 040707-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 22015005-22052023 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22018599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 336 (D336E)
Ref Sequence ENSEMBL: ENSMUSP00000003501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000003501] [ENSMUST00000115331] [ENSMUST00000215901] [ENSMUST00000216344]
AlphaFold Q60900
PDB Structure SOLUTION STRUCTURE OF THE FIRST RNA-BINDING DOMAIN (RBD1) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE SECOND RNA-BINDING DOMAIN (RBD2) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE HUC RBD1-RBD2 COMPLEXED WITH THE AU-RICH ELEMENT [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000003493
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003501
AA Change: D336E

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410
AA Change: D336E

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115331
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213700
Predicted Effect probably benign
Transcript: ENSMUST00000215901
Predicted Effect probably benign
Transcript: ENSMUST00000216344
Meta Mutation Damage Score 0.0962 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain-specific preweaning lethality, abnormal cortical hypersynchronization and non-convulsive electropgraphic seizure. Mice heterozygous for the allele exhibit abnormal brain wave pattern and spike wave discharge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Elavl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Elavl3 APN 9 22036718 missense probably damaging 1.00
IGL02740:Elavl3 APN 9 22036379 missense probably benign 0.06
IGL03011:Elavl3 APN 9 22036316 missense probably damaging 1.00
IGL03211:Elavl3 APN 9 22018678 missense probably damaging 1.00
R0022:Elavl3 UTSW 9 22036871 splice site probably benign
R0105:Elavl3 UTSW 9 22036833 missense possibly damaging 0.84
R0850:Elavl3 UTSW 9 22036763 missense probably damaging 0.96
R1496:Elavl3 UTSW 9 22026165 splice site probably benign
R1499:Elavl3 UTSW 9 22018579 missense probably damaging 0.97
R3500:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3715:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3937:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3938:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R4791:Elavl3 UTSW 9 22024678 missense probably damaging 0.99
R4856:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4886:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4962:Elavl3 UTSW 9 22036811 missense probably benign 0.06
R5526:Elavl3 UTSW 9 22036326 missense probably benign
R5643:Elavl3 UTSW 9 22018733 missense probably benign 0.12
R6593:Elavl3 UTSW 9 22018547 missense possibly damaging 0.58
R7102:Elavl3 UTSW 9 22018729 missense possibly damaging 0.72
R7897:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
R7941:Elavl3 UTSW 9 22036316 missense possibly damaging 0.94
R8710:Elavl3 UTSW 9 22026553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTGGTGTTTATGCAG -3'
(R):5'- AAAGTAGTCCCCTGTCGCTC -3'

Sequencing Primer
(F):5'- TCGAGATTGCGCACACTC -3'
(R):5'- CCATCGATGGCATGAGTGG -3'
Posted On 2015-01-23