Incidental Mutation 'R3714:Ndufs7'
ID 259803
Institutional Source Beutler Lab
Gene Symbol Ndufs7
Ensembl Gene ENSMUSG00000020153
Gene Name NADH dehydrogenase (ubiquinone) Fe-S protein 7
Synonyms
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80249121-80256794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80252421 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 14 (I14T)
Ref Sequence ENSEMBL: ENSMUSP00000101003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020361] [ENSMUST00000105364]
AlphaFold Q9DC70
Predicted Effect probably benign
Transcript: ENSMUST00000020361
AA Change: I14T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020361
Gene: ENSMUSG00000020153
AA Change: I14T

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105364
AA Change: I14T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101003
Gene: ENSMUSG00000020153
AA Change: I14T

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157063
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Ndufs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Ndufs7 APN 10 80256005 nonsense probably null
IGL00940:Ndufs7 APN 10 80255121 missense probably damaging 0.98
BB007:Ndufs7 UTSW 10 80253785 critical splice donor site probably null
BB017:Ndufs7 UTSW 10 80253785 critical splice donor site probably null
R0539:Ndufs7 UTSW 10 80254831 splice site probably benign
R1727:Ndufs7 UTSW 10 80256019 splice site probably benign
R4600:Ndufs7 UTSW 10 80256667 nonsense probably null
R4603:Ndufs7 UTSW 10 80256667 nonsense probably null
R5437:Ndufs7 UTSW 10 80254924 missense possibly damaging 0.63
R7604:Ndufs7 UTSW 10 80253697 missense probably benign 0.00
R7732:Ndufs7 UTSW 10 80253784 critical splice donor site probably null
R7930:Ndufs7 UTSW 10 80253785 critical splice donor site probably null
R8898:Ndufs7 UTSW 10 80253785 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGAAGCAGCTGACTTGG -3'
(R):5'- TCCCTGCATACCATGTGAGG -3'

Sequencing Primer
(F):5'- AAGCAGCTGACTTGGGTCCTG -3'
(R):5'- TGCATACCATGTGAGGACACCTG -3'
Posted On 2015-01-23