Incidental Mutation 'R3714:9930111J21Rik1'
ID 259804
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik1
Ensembl Gene ENSMUSG00000069893
Gene Name RIKEN cDNA 9930111J21 gene 1
Synonyms 9930111J21Rik
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R3714 (G1)
Quality Score 174
Status Not validated
Chromosome 11
Chromosomal Location 48946150-48979398 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48947976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 595 (T595A)
Ref Sequence ENSEMBL: ENSMUSP00000095102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
AlphaFold Q5SVP0
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097494
AA Change: T595A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893
AA Change: T595A

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104958
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Meta Mutation Damage Score 0.5383 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in 9930111J21Rik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:9930111J21Rik1 APN 11 48948212 missense possibly damaging 0.66
IGL02189:9930111J21Rik1 APN 11 48947421 missense probably benign 0.09
IGL02554:9930111J21Rik1 APN 11 48948003 missense probably damaging 1.00
IGL03172:9930111J21Rik1 APN 11 48948176 missense probably damaging 1.00
IGL03334:9930111J21Rik1 APN 11 48947475 missense probably benign 0.09
R0502:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R0503:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R2023:9930111J21Rik1 UTSW 11 48948420 missense possibly damaging 0.51
R3704:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3705:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3715:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3961:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3962:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R4867:9930111J21Rik1 UTSW 11 48948548 critical splice acceptor site probably null
R5033:9930111J21Rik1 UTSW 11 48947706 missense probably damaging 1.00
R5159:9930111J21Rik1 UTSW 11 48948525 missense probably benign 0.06
R6567:9930111J21Rik1 UTSW 11 48948123 missense probably benign 0.26
R6774:9930111J21Rik1 UTSW 11 48947316 missense possibly damaging 0.94
R7730:9930111J21Rik1 UTSW 11 48947876 missense probably benign 0.19
R7863:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
R8408:9930111J21Rik1 UTSW 11 48948002 missense probably damaging 1.00
R9381:9930111J21Rik1 UTSW 11 48948377 missense probably damaging 1.00
R9400:9930111J21Rik1 UTSW 11 48948417 missense possibly damaging 0.82
X0067:9930111J21Rik1 UTSW 11 48948042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAAGAGGTGGCGCTTG -3'
(R):5'- TTGCCTGGCATTGGGTCTAC -3'

Sequencing Primer
(F):5'- CTCAGTAGGGTGGTCTCCAG -3'
(R):5'- GGTCTACTACCTTCCCACCAC -3'
Posted On 2015-01-23