Mutagenetix > Incidental Mutations

Incidental Mutation 'R3714:Mink1'

259806

Institutional Source

Beutler Lab

Gene Symbol

Mink1

Ensembl Gene

ENSMUSG00000020827

Gene Name

misshapen-like kinase 1 (zebrafish)

Synonyms

Map4k6, Ysk2, MINK, Misshapen/NIKs-related kinase

MMRRC Submission

040707-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70562881-70614483 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70608950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 773 (R773L)

Ref Sequence

ENSEMBL: ENSMUSP00000072091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]

AlphaFold

Q9JM52

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072237
AA Change: R773L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: R773L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	837	874	N/A	INTRINSIC
CNH	1026	1324	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072873
AA Change: R773L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: R773L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	829	853	N/A	INTRINSIC
CNH	1019	1317	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079244
AA Change: R770L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: R770L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	314	338	N/A	INTRINSIC
coiled coil region	348	493	N/A	INTRINSIC
low complexity region	554	566	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	643	656	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	826	850	N/A	INTRINSIC
CNH	1016	1314	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102558
AA Change: R736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: R736L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	792	816	N/A	INTRINSIC
CNH	982	1280	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102559
AA Change: R736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: R736L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	800	824	N/A	INTRINSIC
CNH	990	1288	1.58e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133310

Predicted Effect

unknown
Transcript: ENSMUST00000136663
AA Change: R626L

SMART Domains

Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: R626L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	140	2.3e-22	PFAM
Pfam:Pkinase	1	143	1.6e-30	PFAM
low complexity region	161	192	N/A	INTRINSIC
coiled coil region	204	349	N/A	INTRINSIC
low complexity region	411	423	N/A	INTRINSIC
low complexity region	474	487	N/A	INTRINSIC
low complexity region	500	513	N/A	INTRINSIC
low complexity region	573	592	N/A	INTRINSIC
low complexity region	691	728	N/A	INTRINSIC
CNH	880	1178	1.58e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142650

Predicted Effect

probably benign
Transcript: ENSMUST00000149845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153503

Predicted Effect

probably benign
Transcript: ENSMUST00000178764

Meta Mutation Damage Score

0.0796

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Mink1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Mink1	APN	11	70603812	missense	probably damaging	0.99
IGL00709:Mink1	APN	11	70613019	missense	probably damaging	0.99
IGL01064:Mink1	APN	11	70603481	missense	probably benign	0.05
IGL02612:Mink1	APN	11	70597226	missense	probably damaging	1.00
IGL02797:Mink1	APN	11	70610350	missense	probably damaging	1.00
IGL03056:Mink1	APN	11	70612583	critical splice donor site	probably null
IGL03066:Mink1	APN	11	70608889	missense	probably benign	0.01
IGL03185:Mink1	APN	11	70603860	missense	probably damaging	1.00
PIT4498001:Mink1	UTSW	11	70598888	missense	probably benign	0.05
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0488:Mink1	UTSW	11	70597204	missense	probably damaging	1.00
R0637:Mink1	UTSW	11	70601676	missense	probably damaging	0.96
R0828:Mink1	UTSW	11	70610145	nonsense	probably null
R1081:Mink1	UTSW	11	70607035	missense	probably benign	0.07
R1175:Mink1	UTSW	11	70611340	missense	probably benign	0.02
R1441:Mink1	UTSW	11	70607114	missense	possibly damaging	0.72
R1532:Mink1	UTSW	11	70602007	missense	probably null	1.00
R1545:Mink1	UTSW	11	70598891	missense	possibly damaging	0.60
R1634:Mink1	UTSW	11	70608880	missense	probably benign	0.00
R1932:Mink1	UTSW	11	70608428	critical splice donor site	probably null
R2033:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R2184:Mink1	UTSW	11	70603797	missense	probably damaging	1.00
R2267:Mink1	UTSW	11	70601724	splice site	probably null
R2268:Mink1	UTSW	11	70601724	splice site	probably null
R2859:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R3713:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3715:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3716:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R3717:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R4607:Mink1	UTSW	11	70606067	missense	possibly damaging	0.72
R4735:Mink1	UTSW	11	70609260	splice site	probably null
R4790:Mink1	UTSW	11	70599041	missense	probably damaging	0.99
R4847:Mink1	UTSW	11	70602028	missense	probably damaging	1.00
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R5081:Mink1	UTSW	11	70605144	missense	probably damaging	0.98
R5310:Mink1	UTSW	11	70607343	missense	probably benign	0.33
R5677:Mink1	UTSW	11	70605165	missense	possibly damaging	0.66
R5767:Mink1	UTSW	11	70606075	missense	possibly damaging	0.53
R5795:Mink1	UTSW	11	70607790	missense	possibly damaging	0.86
R5888:Mink1	UTSW	11	70610059	unclassified	probably benign
R5950:Mink1	UTSW	11	70609586	missense	possibly damaging	0.81
R6024:Mink1	UTSW	11	70599089	missense	possibly damaging	0.71
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6058:Mink1	UTSW	11	70611720	missense	possibly damaging	0.96
R6144:Mink1	UTSW	11	70610652	missense	possibly damaging	0.66
R6154:Mink1	UTSW	11	70610101	missense	possibly damaging	0.46
R6218:Mink1	UTSW	11	70598894	missense	possibly damaging	0.94
R6262:Mink1	UTSW	11	70603325	splice site	probably null
R6269:Mink1	UTSW	11	70598987	missense	probably damaging	1.00
R6273:Mink1	UTSW	11	70611435	nonsense	probably null
R6301:Mink1	UTSW	11	70612294	missense	possibly damaging	0.71
R6603:Mink1	UTSW	11	70609593	missense	probably damaging	0.96
R6876:Mink1	UTSW	11	70607435	missense	probably benign	0.02
R7030:Mink1	UTSW	11	70607775	missense	possibly damaging	0.46
R7050:Mink1	UTSW	11	70612332	missense	possibly damaging	0.93
R7094:Mink1	UTSW	11	70610075	splice site	probably null
R7135:Mink1	UTSW	11	70603503	missense	probably damaging	1.00
R7238:Mink1	UTSW	11	70611479	critical splice donor site	probably null
R7320:Mink1	UTSW	11	70599073	missense	probably benign	0.23
R7396:Mink1	UTSW	11	70605168	missense	possibly damaging	0.73
R7446:Mink1	UTSW	11	70609629	missense	probably benign	0.18
R7723:Mink1	UTSW	11	70612910	missense	probably benign	0.16
R7896:Mink1	UTSW	11	70612282	missense	possibly damaging	0.71
R8058:Mink1	UTSW	11	70603768	nonsense	probably null
R8082:Mink1	UTSW	11	70613277	missense	possibly damaging	0.71
R8160:Mink1	UTSW	11	70606081	nonsense	probably null
R8335:Mink1	UTSW	11	70609575	missense	probably damaging	0.97
R8353:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70
R8453:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70
R8732:Mink1	UTSW	11	70610076	critical splice acceptor site	probably null
R9072:Mink1	UTSW	11	70608381	missense	possibly damaging	0.86
R9073:Mink1	UTSW	11	70608381	missense	possibly damaging	0.86
R9324:Mink1	UTSW	11	70611651	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCTAGGTAATGGAGTTGCCCC -3'
(R):5'- TATCTACAGAATGGGCCCGG -3'

Sequencing Primer
(F):5'- TAATGGAGTTGCCCCCTGAC -3'
(R):5'- GGTCCTAGGCCACCAAA -3'

Posted On

2015-01-23