Incidental Mutation 'R3714:Mink1'
ID 259806
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Name misshapen-like kinase 1 (zebrafish)
Synonyms Map4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission 040707-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70562881-70614483 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70608950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 773 (R773L)
Ref Sequence ENSEMBL: ENSMUSP00000072091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
AlphaFold Q9JM52
Predicted Effect possibly damaging
Transcript: ENSMUST00000072237
AA Change: R773L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: R773L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072873
AA Change: R773L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: R773L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079244
AA Change: R770L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: R770L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102558
AA Change: R736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: R736L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102559
AA Change: R736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: R736L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133310
Predicted Effect unknown
Transcript: ENSMUST00000136663
AA Change: R626L
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: R626L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
R7396:Mink1 UTSW 11 70605168 missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70609629 missense probably benign 0.18
R7723:Mink1 UTSW 11 70612910 missense probably benign 0.16
R7896:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70603768 nonsense probably null
R8082:Mink1 UTSW 11 70613277 missense possibly damaging 0.71
R8160:Mink1 UTSW 11 70606081 nonsense probably null
R8335:Mink1 UTSW 11 70609575 missense probably damaging 0.97
R8353:Mink1 UTSW 11 70610328 missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70610328 missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70610076 critical splice acceptor site probably null
R9072:Mink1 UTSW 11 70608381 missense possibly damaging 0.86
R9073:Mink1 UTSW 11 70608381 missense possibly damaging 0.86
R9324:Mink1 UTSW 11 70611651 missense probably damaging 0.98
R9596:Mink1 UTSW 11 70607089 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTAGGTAATGGAGTTGCCCC -3'
(R):5'- TATCTACAGAATGGGCCCGG -3'

Sequencing Primer
(F):5'- TAATGGAGTTGCCCCCTGAC -3'
(R):5'- GGTCCTAGGCCACCAAA -3'
Posted On 2015-01-23