Mutagenetix > Incidental Mutation

Incidental Mutation 'R3714:Prkch'

259808

Institutional Source

Beutler Lab

Gene Symbol

Prkch

Ensembl Gene

ENSMUSG00000021108

Gene Name

protein kinase C, eta

Synonyms

Pkch

MMRRC Submission

040707-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73584796-73778185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 73775516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 630 (P630S)

Ref Sequence

ENSEMBL: ENSMUSP00000021527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]

AlphaFold

P23298

Predicted Effect

probably damaging
Transcript: ENSMUST00000021527
AA Change: P630S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: P630S

Domain	Start	End	E-Value	Type
C2	11	117	1.28e-13	SMART
C1	172	222	7.92e-14	SMART
C1	246	295	2.48e-15	SMART
S_TKc	355	614	5.62e-100	SMART
S_TK_X	615	678	8.32e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221153

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Prkch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Prkch	APN	12	73702589	splice site	probably benign
IGL00548:Prkch	APN	12	73702811	missense	probably damaging	1.00
IGL01310:Prkch	APN	12	73759013	missense	possibly damaging	0.78
IGL01782:Prkch	APN	12	73759662	missense	probably damaging	1.00
IGL02335:Prkch	APN	12	73702512	missense	probably benign	0.00
Nighthawk	UTSW	12	73721842	missense	probably damaging	1.00
Topsoil	UTSW	12	73585527	critical splice donor site	probably null
wolfcreek	UTSW	12	73759710	missense	probably damaging	1.00
G1Funyon:Prkch	UTSW	12	73702764	missense	possibly damaging	0.71
R0084:Prkch	UTSW	12	73697987	missense	possibly damaging	0.87
R0127:Prkch	UTSW	12	73721787	missense	possibly damaging	0.94
R0471:Prkch	UTSW	12	73691652	missense	probably benign	0.03
R0490:Prkch	UTSW	12	73759676	missense	probably damaging	1.00
R1402:Prkch	UTSW	12	73585389	missense	probably damaging	1.00
R1402:Prkch	UTSW	12	73585389	missense	probably damaging	1.00
R1552:Prkch	UTSW	12	73702546	missense	probably benign	0.33
R1572:Prkch	UTSW	12	73649357	critical splice donor site	probably null
R1651:Prkch	UTSW	12	73759001	missense	possibly damaging	0.88
R2114:Prkch	UTSW	12	73702516	missense	probably benign
R4515:Prkch	UTSW	12	73702838	missense	possibly damaging	0.76
R4749:Prkch	UTSW	12	73692960	missense	probably damaging	1.00
R4977:Prkch	UTSW	12	73702893	missense	possibly damaging	0.52
R5381:Prkch	UTSW	12	73691592	missense	probably damaging	0.99
R5682:Prkch	UTSW	12	73697950	missense	probably damaging	1.00
R6526:Prkch	UTSW	12	73702775	missense	probably damaging	1.00
R6864:Prkch	UTSW	12	73759617	missense	probably damaging	1.00
R7484:Prkch	UTSW	12	73585527	critical splice donor site	probably null
R8074:Prkch	UTSW	12	73700267	missense	possibly damaging	0.49
R8294:Prkch	UTSW	12	73759710	missense	probably damaging	1.00
R8301:Prkch	UTSW	12	73702764	missense	possibly damaging	0.71
R8312:Prkch	UTSW	12	73760584	missense	noncoding transcript
R8734:Prkch	UTSW	12	73585244	missense	possibly damaging	0.62
R8766:Prkch	UTSW	12	73702538	missense	probably benign	0.01
R8998:Prkch	UTSW	12	73696199	missense	probably damaging	1.00
R8999:Prkch	UTSW	12	73696199	missense	probably damaging	1.00
R9058:Prkch	UTSW	12	73775534	critical splice donor site	probably null
R9152:Prkch	UTSW	12	73691644	missense	possibly damaging	0.91
R9176:Prkch	UTSW	12	73700194	missense	probably damaging	1.00
R9194:Prkch	UTSW	12	73721842	missense	probably damaging	1.00
R9691:Prkch	UTSW	12	73758956	missense	probably damaging	1.00
R9764:Prkch	UTSW	12	73700304	missense	probably benign	0.00
R9794:Prkch	UTSW	12	73697970	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- CTGTGAGACGGCTGCATATG -3'
(R):5'- ATAGTCAACACATGGAGAGACATTG -3'

Sequencing Primer
(F):5'- ACGGCTGCATATGAATGAATG -3'
(R):5'- GTCTCAGGGACAACCAGC -3'

Posted On

2015-01-23