Incidental Mutation 'R3714:Vmn1r218'
ID259810
Institutional Source Beutler Lab
Gene Symbol Vmn1r218
Ensembl Gene ENSMUSG00000115020
Gene Namevomeronasal 1 receptor 218
SynonymsV1ri5
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R3714 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23133155-23146112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23136911 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 63 (N63Y)
Ref Sequence ENSEMBL: ENSMUSP00000154303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074992] [ENSMUST00000226692] [ENSMUST00000227050] [ENSMUST00000227160] [ENSMUST00000227741]
Predicted Effect probably damaging
Transcript: ENSMUST00000074992
AA Change: N143Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074519
Gene: ENSMUSG00000115020
AA Change: N143Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 288 2e-7 PFAM
Pfam:V1R 33 297 5.4e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226692
AA Change: N143Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227050
AA Change: N143Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227160
AA Change: N63Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227741
AA Change: N63Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228348
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Vmn1r218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02014:Vmn1r218 APN 13 23136831 missense probably damaging 0.97
IGL02670:Vmn1r218 APN 13 23137004 missense probably benign 0.01
IGL03085:Vmn1r218 APN 13 23137311 missense possibly damaging 0.76
IGL03334:Vmn1r218 APN 13 23136618 missense probably damaging 1.00
R0049:Vmn1r218 UTSW 13 23137055 nonsense probably null
R0049:Vmn1r218 UTSW 13 23137055 nonsense probably null
R1387:Vmn1r218 UTSW 13 23137308 missense probably damaging 1.00
R1959:Vmn1r218 UTSW 13 23136513 missense probably damaging 0.96
R3713:Vmn1r218 UTSW 13 23136911 missense probably damaging 1.00
R4037:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4038:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4039:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4432:Vmn1r218 UTSW 13 23137242 missense possibly damaging 0.87
R5255:Vmn1r218 UTSW 13 23136711 missense possibly damaging 0.92
R5521:Vmn1r218 UTSW 13 23136573 missense probably benign 0.01
R7384:Vmn1r218 UTSW 13 23136725 missense probably benign 0.00
R7565:Vmn1r218 UTSW 13 23136660 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGAGTCACAGATATAGTCACAGTG -3'
(R):5'- ACTGCTCCAGCCCATTAGAC -3'

Sequencing Primer
(F):5'- GAAACTTCTTAGGAGATATTGGCTG -3'
(R):5'- AGCCCATTAGACTCTGAAAAATAAC -3'
Posted On2015-01-23