Incidental Mutation 'R3714:Rnf31'
ID 259811
Institutional Source Beutler Lab
Gene Symbol Rnf31
Ensembl Gene ENSMUSG00000047098
Gene Name ring finger protein 31
Synonyms Paul, HOIP
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55591708-55603693 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55603394 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 884 (D884E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000138037]
AlphaFold Q924T7
Predicted Effect probably benign
Transcript: ENSMUST00000019443
AA Change: D1039E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: D1039E

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126269
Predicted Effect probably benign
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably benign
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect probably benign
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140178
AA Change: D884E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: D884E

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably benign
Transcript: ENSMUST00000226275
Predicted Effect probably benign
Transcript: ENSMUST00000227708
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Rnf31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf31 APN 14 55592319 splice site probably null
IGL01532:Rnf31 APN 14 55602623 missense probably damaging 0.99
IGL02118:Rnf31 APN 14 55599112 missense probably damaging 1.00
IGL02272:Rnf31 APN 14 55598782 missense probably damaging 1.00
IGL02893:Rnf31 APN 14 55599109 missense probably damaging 1.00
IGL02939:Rnf31 APN 14 55595674 missense probably benign 0.30
R0285:Rnf31 UTSW 14 55601389 missense probably damaging 0.96
R0678:Rnf31 UTSW 14 55601713 nonsense probably null
R0924:Rnf31 UTSW 14 55593002 unclassified probably benign
R1386:Rnf31 UTSW 14 55596764 missense probably damaging 1.00
R1507:Rnf31 UTSW 14 55598982 nonsense probably null
R2122:Rnf31 UTSW 14 55596197 missense probably damaging 1.00
R2164:Rnf31 UTSW 14 55592537 missense possibly damaging 0.90
R3921:Rnf31 UTSW 14 55601142 missense probably damaging 1.00
R4348:Rnf31 UTSW 14 55601098 frame shift probably null
R4349:Rnf31 UTSW 14 55601098 frame shift probably null
R4350:Rnf31 UTSW 14 55601098 frame shift probably null
R4351:Rnf31 UTSW 14 55601098 frame shift probably null
R4353:Rnf31 UTSW 14 55601098 frame shift probably null
R4472:Rnf31 UTSW 14 55603320 missense probably damaging 1.00
R5004:Rnf31 UTSW 14 55592182 missense probably damaging 1.00
R5245:Rnf31 UTSW 14 55601706 missense probably damaging 1.00
R5286:Rnf31 UTSW 14 55592236 missense probably damaging 1.00
R5669:Rnf31 UTSW 14 55596704 missense probably damaging 1.00
R5750:Rnf31 UTSW 14 55598686 missense probably damaging 1.00
R6377:Rnf31 UTSW 14 55595527 missense probably damaging 1.00
R7009:Rnf31 UTSW 14 55592551 missense probably benign 0.00
R7018:Rnf31 UTSW 14 55592233 missense probably damaging 1.00
R7670:Rnf31 UTSW 14 55594361 missense probably benign 0.08
R7876:Rnf31 UTSW 14 55593077 critical splice donor site probably null
R8490:Rnf31 UTSW 14 55596109 missense probably damaging 1.00
R8818:Rnf31 UTSW 14 55594939 missense probably benign 0.10
R8900:Rnf31 UTSW 14 55596232 missense probably damaging 1.00
R9246:Rnf31 UTSW 14 55596241 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGAGTGCGTACAACATAACAC -3'
(R):5'- GCAATACTCTGTCCCAAGGG -3'

Sequencing Primer
(F):5'- TGGGCGCATGTGGTTAATATCAAAC -3'
(R):5'- GGTACCTCTTCTCTCAGCTTCTG -3'
Posted On 2015-01-23