Mutagenetix > Incidental Mutation

Incidental Mutation 'R3714:Rnf31'

259811

Institutional Source

Beutler Lab

Gene Symbol

Rnf31

Ensembl Gene

ENSMUSG00000047098

Gene Name

ring finger protein 31

Synonyms

Paul, HOIP

MMRRC Submission

040707-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55591708-55603693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55603394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 884 (D884E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000138037]

AlphaFold

Q924T7

Predicted Effect

probably benign
Transcript: ENSMUST00000019443
AA Change: D1039E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: D1039E

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	68	148	7.1e-17	PFAM
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	405	429	4.86e-1	SMART
Pfam:HOIP-UBA	477	622	2.4e-54	PFAM
Blast:RING	693	741	7e-25	BLAST
IBR	773	835	3.18e-14	SMART
IBR	847	924	5.35e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126269

Predicted Effect

probably benign
Transcript: ENSMUST00000130697

SMART Domains

Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

Domain	Start	End	E-Value	Type
IRF	5	117	1.19e-53	SMART
low complexity region	158	182	N/A	INTRINSIC
low complexity region	185	194	N/A	INTRINSIC
IRF-3	211	377	1.13e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133903

Predicted Effect

probably benign
Transcript: ENSMUST00000134863

SMART Domains

Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

Domain	Start	End	E-Value	Type
low complexity region	34	58	N/A	INTRINSIC
IRF	71	183	1.19e-53	SMART
low complexity region	224	248	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
IRF-3	277	443	1.13e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136109

Predicted Effect

probably benign
Transcript: ENSMUST00000138037

SMART Domains

Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

Domain	Start	End	E-Value	Type
IRF	23	135	1.19e-53	SMART
low complexity region	176	200	N/A	INTRINSIC
low complexity region	203	212	N/A	INTRINSIC
IRF-3	229	395	1.13e-59	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000140178
AA Change: D884E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: D884E

Domain	Start	End	E-Value	Type
PDB:4OYJ\|M	2	85	1e-29	PDB
low complexity region	164	196	N/A	INTRINSIC
ZnF_RBZ	200	224	2.56e-1	SMART
ZnF_RBZ	248	272	6.93e-5	SMART
ZnF_RBZ	307	331	4.86e-1	SMART
Pfam:HOIP-UBA	369	468	1.1e-31	PFAM
Blast:RING	539	587	9e-25	BLAST
IBR	619	681	3.18e-14	SMART
IBR	693	770	5.35e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145680

Predicted Effect

probably benign
Transcript: ENSMUST00000226275

Predicted Effect

probably benign
Transcript: ENSMUST00000227708

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Rnf31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rnf31	APN	14	55592319	splice site	probably null
IGL01532:Rnf31	APN	14	55602623	missense	probably damaging	0.99
IGL02118:Rnf31	APN	14	55599112	missense	probably damaging	1.00
IGL02272:Rnf31	APN	14	55598782	missense	probably damaging	1.00
IGL02893:Rnf31	APN	14	55599109	missense	probably damaging	1.00
IGL02939:Rnf31	APN	14	55595674	missense	probably benign	0.30
R0285:Rnf31	UTSW	14	55601389	missense	probably damaging	0.96
R0678:Rnf31	UTSW	14	55601713	nonsense	probably null
R0924:Rnf31	UTSW	14	55593002	unclassified	probably benign
R1386:Rnf31	UTSW	14	55596764	missense	probably damaging	1.00
R1507:Rnf31	UTSW	14	55598982	nonsense	probably null
R2122:Rnf31	UTSW	14	55596197	missense	probably damaging	1.00
R2164:Rnf31	UTSW	14	55592537	missense	possibly damaging	0.90
R3921:Rnf31	UTSW	14	55601142	missense	probably damaging	1.00
R4348:Rnf31	UTSW	14	55601098	frame shift	probably null
R4349:Rnf31	UTSW	14	55601098	frame shift	probably null
R4350:Rnf31	UTSW	14	55601098	frame shift	probably null
R4351:Rnf31	UTSW	14	55601098	frame shift	probably null
R4353:Rnf31	UTSW	14	55601098	frame shift	probably null
R4472:Rnf31	UTSW	14	55603320	missense	probably damaging	1.00
R5004:Rnf31	UTSW	14	55592182	missense	probably damaging	1.00
R5245:Rnf31	UTSW	14	55601706	missense	probably damaging	1.00
R5286:Rnf31	UTSW	14	55592236	missense	probably damaging	1.00
R5669:Rnf31	UTSW	14	55596704	missense	probably damaging	1.00
R5750:Rnf31	UTSW	14	55598686	missense	probably damaging	1.00
R6377:Rnf31	UTSW	14	55595527	missense	probably damaging	1.00
R7009:Rnf31	UTSW	14	55592551	missense	probably benign	0.00
R7018:Rnf31	UTSW	14	55592233	missense	probably damaging	1.00
R7670:Rnf31	UTSW	14	55594361	missense	probably benign	0.08
R7876:Rnf31	UTSW	14	55593077	critical splice donor site	probably null
R8490:Rnf31	UTSW	14	55596109	missense	probably damaging	1.00
R8818:Rnf31	UTSW	14	55594939	missense	probably benign	0.10
R8900:Rnf31	UTSW	14	55596232	missense	probably damaging	1.00
R9246:Rnf31	UTSW	14	55596241	missense	probably benign	0.01
R9454:Rnf31	UTSW	14	55596152	missense
R9526:Rnf31	UTSW	14	55598812	critical splice donor site	probably null
R9756:Rnf31	UTSW	14	55599125	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGAGTGCGTACAACATAACAC -3'
(R):5'- GCAATACTCTGTCCCAAGGG -3'

Sequencing Primer
(F):5'- TGGGCGCATGTGGTTAATATCAAAC -3'
(R):5'- GGTACCTCTTCTCTCAGCTTCTG -3'

Posted On

2015-01-23