Incidental Mutation 'R3714:Cpb2'
ID 259813
Institutional Source Beutler Lab
Gene Symbol Cpb2
Ensembl Gene ENSMUSG00000021999
Gene Name carboxypeptidase B2 (plasma)
Synonyms carboxypeptidase U, TAFI, carboxypeptidase R, CPR, CPU, 1110032P04Rik, thrombin-activatable fibrinolysis inhibitor, 4930405E17Rik
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 75242287-75283555 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 75283217 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022576] [ENSMUST00000022577] [ENSMUST00000227049]
AlphaFold Q9JHH6
Predicted Effect probably null
Transcript: ENSMUST00000022576
SMART Domains Protein: ENSMUSP00000022576
Gene: ENSMUSG00000021999

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Propep_M14 28 104 2.3e-17 PFAM
Zn_pept 122 406 2.1e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022577
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226417
Predicted Effect probably benign
Transcript: ENSMUST00000227049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227817
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase B, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme, and secreted into plasma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice exhibit altered plasma clot lysis and may show reduced bleomycin-induced lung fibrosis, impaired healing of cutaneous wounds and colonic anastomoses, altered glomerular structure, or complement-mediated lethal inflammation after LPS sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Cpb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Cpb2 APN 14 75275093 missense possibly damaging 0.64
IGL00925:Cpb2 APN 14 75260750 missense possibly damaging 0.56
IGL01069:Cpb2 APN 14 75270775 missense probably damaging 1.00
IGL01521:Cpb2 APN 14 75257631 missense probably damaging 1.00
IGL02331:Cpb2 APN 14 75283404 missense possibly damaging 0.93
IGL02947:Cpb2 APN 14 75283318 missense probably damaging 1.00
IGL02961:Cpb2 APN 14 75265383 missense probably benign
PIT4677001:Cpb2 UTSW 14 75256023 missense probably benign
R0271:Cpb2 UTSW 14 75257709 splice site probably null
R0277:Cpb2 UTSW 14 75265458 missense probably damaging 1.00
R0372:Cpb2 UTSW 14 75242377 missense probably benign 0.01
R1893:Cpb2 UTSW 14 75255963 missense probably benign 0.44
R1926:Cpb2 UTSW 14 75242397 missense probably benign 0.07
R2372:Cpb2 UTSW 14 75268050 missense probably damaging 0.97
R2923:Cpb2 UTSW 14 75256033 critical splice donor site probably null
R5958:Cpb2 UTSW 14 75283387 missense probably damaging 1.00
R5987:Cpb2 UTSW 14 75260688 missense probably damaging 1.00
R6354:Cpb2 UTSW 14 75257705 critical splice donor site probably null
R6495:Cpb2 UTSW 14 75275079 missense probably damaging 1.00
R6984:Cpb2 UTSW 14 75265458 missense possibly damaging 0.78
R7211:Cpb2 UTSW 14 75274990 missense probably damaging 1.00
R7380:Cpb2 UTSW 14 75256009 missense possibly damaging 0.77
R7444:Cpb2 UTSW 14 75283342 missense probably damaging 0.99
R7625:Cpb2 UTSW 14 75272549 missense possibly damaging 0.89
R7784:Cpb2 UTSW 14 75275040 missense probably damaging 1.00
R8436:Cpb2 UTSW 14 75272575 missense probably damaging 1.00
R8947:Cpb2 UTSW 14 75278187 missense probably damaging 1.00
R9003:Cpb2 UTSW 14 75242428 splice site probably benign
R9272:Cpb2 UTSW 14 75283363 missense probably damaging 1.00
R9391:Cpb2 UTSW 14 75270696 missense probably damaging 0.98
R9409:Cpb2 UTSW 14 75268082 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCAGTTATCACTCCTTAATCAG -3'
(R):5'- CACTCTTAAGCTCAAAGTAGTGTGC -3'

Sequencing Primer
(F):5'- CAGATTATTGTTGAGTTCTGGGCAAC -3'
(R):5'- GTGTTCCTGATGACATGCCAAAC -3'
Posted On 2015-01-23