Incidental Mutation 'R3714:Adck5'
ID 259816
Institutional Source Beutler Lab
Gene Symbol Adck5
Ensembl Gene ENSMUSG00000022550
Gene Name aarF domain containing kinase 5
Synonyms
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 76576358-76595816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76593938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 229 (V229I)
Ref Sequence ENSEMBL: ENSMUSP00000125055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000231042] [ENSMUST00000230157]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071898
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160410
Predicted Effect probably damaging
Transcript: ENSMUST00000160784
AA Change: V229I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550
AA Change: V229I

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 9.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161311
Predicted Effect probably benign
Transcript: ENSMUST00000161612
SMART Domains Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161732
SMART Domains Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161783
Predicted Effect probably damaging
Transcript: ENSMUST00000162503
AA Change: V229I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550
AA Change: V229I

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 2.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230903
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231037
Predicted Effect probably benign
Transcript: ENSMUST00000230157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229007
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Adck5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Adck5 APN 15 76589100 missense possibly damaging 0.59
IGL01366:Adck5 APN 15 76595616 makesense probably null
IGL01534:Adck5 APN 15 76594726 missense probably damaging 1.00
IGL02066:Adck5 APN 15 76595206 missense probably damaging 0.96
IGL02615:Adck5 APN 15 76589167 missense possibly damaging 0.69
IGL02746:Adck5 APN 15 76589154 missense probably benign 0.26
R0865:Adck5 UTSW 15 76595643 missense probably damaging 0.98
R0946:Adck5 UTSW 15 76593286 missense possibly damaging 0.82
R3945:Adck5 UTSW 15 76595200 missense probably damaging 1.00
R4373:Adck5 UTSW 15 76594335 unclassified probably benign
R4377:Adck5 UTSW 15 76594335 unclassified probably benign
R5343:Adck5 UTSW 15 76595580 missense probably damaging 0.98
R5372:Adck5 UTSW 15 76594507 unclassified probably benign
R5890:Adck5 UTSW 15 76593585 missense probably damaging 1.00
R6151:Adck5 UTSW 15 76594687 missense possibly damaging 0.81
R6277:Adck5 UTSW 15 76593263 missense possibly damaging 0.58
R6530:Adck5 UTSW 15 76593847 missense probably benign 0.00
R7163:Adck5 UTSW 15 76593816 missense probably damaging 1.00
R7427:Adck5 UTSW 15 76594385 missense possibly damaging 0.78
R7447:Adck5 UTSW 15 76595196 missense possibly damaging 0.93
R7685:Adck5 UTSW 15 76595388 nonsense probably null
R7745:Adck5 UTSW 15 76594548 missense probably benign 0.36
R8912:Adck5 UTSW 15 76593235 missense probably damaging 1.00
R9133:Adck5 UTSW 15 76576412 start gained probably benign
X0013:Adck5 UTSW 15 76595342 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTTCCTTGAAGACTTCCAGGC -3'
(R):5'- GATCGGTCAGGTCCAGGTTTAG -3'

Sequencing Primer
(F):5'- TCCCTAATGAACTCTTCCAGGAG -3'
(R):5'- CAGGTCCAGGTTTAGCATTTAC -3'
Posted On 2015-01-23