Mutagenetix > Incidental Mutations

Incidental Mutation 'R3714:Prdm9'

259818

Institutional Source

Beutler Lab

Gene Symbol

Prdm9

Ensembl Gene

ENSMUSG00000051977

Gene Name

PR domain containing 9

Synonyms

Dsbc1, repro7, Rcr1, Meisetz, G1-419-29

MMRRC Submission

040707-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.369) question?

Stock #

R3714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15543079-15564354 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 15557361 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 154 (K154*)

Ref Sequence

ENSEMBL: ENSMUSP00000131871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000147532] [ENSMUST00000167994]

AlphaFold

Q96EQ9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128267

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139911

Predicted Effect

probably null
Transcript: ENSMUST00000147532
AA Change: K29*

SMART Domains

Protein: ENSMUSP00000118454
Gene: ENSMUSG00000051977
AA Change: K29*

Domain	Start	End	E-Value	Type
Pfam:SSXRD	49	81	1.8e-19	PFAM
SET	123	243	2.56e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000167994
AA Change: K154*

SMART Domains

Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977
AA Change: K154*

Domain	Start	End	E-Value	Type
KRAB	30	89	5.54e-8	SMART
Pfam:SSXRD	175	205	1.5e-20	PFAM
SET	248	368	2.56e-2	SMART
ZnF_C2H2	392	415	3.29e-1	SMART
ZnF_C2H2	516	535	4.74e1	SMART
ZnF_C2H2	541	563	9.73e-4	SMART
ZnF_C2H2	569	591	1.3e-4	SMART
ZnF_C2H2	597	619	1.3e-4	SMART
ZnF_C2H2	625	647	4.24e-4	SMART
ZnF_C2H2	653	675	4.24e-4	SMART
ZnF_C2H2	681	703	1.95e-3	SMART
ZnF_C2H2	709	731	5.99e-4	SMART
ZnF_C2H2	737	759	1.95e-3	SMART
ZnF_C2H2	765	787	1.95e-3	SMART
ZnF_C2H2	793	815	1.3e-4	SMART
ZnF_C2H2	821	843	1.6e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Fuk	G	T	8: 110,887,259	D723E	probably damaging	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Prdm9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Prdm9	APN	17	15553346	missense	probably benign	0.11
IGL02322:Prdm9	APN	17	15562848	missense	probably damaging	0.99
IGL02354:Prdm9	APN	17	15562847	missense	probably damaging	1.00
IGL02361:Prdm9	APN	17	15562847	missense	probably damaging	1.00
IGL02724:Prdm9	APN	17	15563260	missense	probably benign	0.07
IGL03120:Prdm9	APN	17	15544931	missense	probably benign
berlin	UTSW	17	15562440	missense	probably damaging	0.96
R0173:Prdm9	UTSW	17	15544013	missense	probably benign	0.02
R0173:Prdm9	UTSW	17	15544035	missense	probably benign	0.00
R0309:Prdm9	UTSW	17	15557384	missense	probably damaging	0.98
R1420:Prdm9	UTSW	17	15544376	missense	probably damaging	1.00
R3498:Prdm9	UTSW	17	15562945	splice site	probably benign
R4118:Prdm9	UTSW	17	15544013	missense	probably benign	0.02
R4369:Prdm9	UTSW	17	15544446	missense	probably benign	0.14
R4691:Prdm9	UTSW	17	15553378	missense	probably benign	0.03
R4742:Prdm9	UTSW	17	15553521	missense	probably damaging	0.99
R4910:Prdm9	UTSW	17	15544323	missense	probably benign	0.08
R5056:Prdm9	UTSW	17	15562417	missense	possibly damaging	0.93
R5130:Prdm9	UTSW	17	15544467	missense	probably benign	0.00
R5175:Prdm9	UTSW	17	15557451	missense	probably benign	0.04
R5187:Prdm9	UTSW	17	15562893	missense	probably damaging	0.98
R5213:Prdm9	UTSW	17	15555154	missense	probably damaging	0.98
R5270:Prdm9	UTSW	17	15553363	missense	probably benign	0.16
R5635:Prdm9	UTSW	17	15562440	missense	probably damaging	0.96
R6753:Prdm9	UTSW	17	15544956	missense	probably benign	0.00
R6857:Prdm9	UTSW	17	15544256	missense	probably benign	0.04
R7041:Prdm9	UTSW	17	15544995	missense	possibly damaging	0.56
R7355:Prdm9	UTSW	17	15545235	missense	probably benign	0.01
R7410:Prdm9	UTSW	17	15544997	missense	possibly damaging	0.73
R7570:Prdm9	UTSW	17	15555652	missense	probably benign	0.14
R7571:Prdm9	UTSW	17	15563264	missense	probably damaging	0.98
R7575:Prdm9	UTSW	17	15544628	missense	probably damaging	1.00
R7593:Prdm9	UTSW	17	15544605	missense	possibly damaging	0.81
R7664:Prdm9	UTSW	17	15555571	missense	probably damaging	0.99
R7755:Prdm9	UTSW	17	15544964	missense	probably damaging	1.00
R7817:Prdm9	UTSW	17	15559049	missense	probably damaging	1.00
R7875:Prdm9	UTSW	17	15553542	nonsense	probably null
R8110:Prdm9	UTSW	17	15554698	missense	probably damaging	1.00
R8222:Prdm9	UTSW	17	15544773	missense	possibly damaging	0.93
R8405:Prdm9	UTSW	17	15544194	missense	probably benign	0.22
R8695:Prdm9	UTSW	17	15544757	missense	probably damaging	1.00
R8947:Prdm9	UTSW	17	15544008	missense	possibly damaging	0.96
X0021:Prdm9	UTSW	17	15553472	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCTTAGACAAGACCAAGTTC -3'
(R):5'- AGAAAGCCTAGCAGATGGCC -3'

Sequencing Primer
(F):5'- GCTTAGACAAGACCAAGTTCAGAAC -3'
(R):5'- AAAGCCTAGCAGATGGCCTCTTG -3'

Posted On

2015-01-23