Incidental Mutation 'R3714:Mc4r'
ID 259823
Institutional Source Beutler Lab
Gene Symbol Mc4r
Ensembl Gene ENSMUSG00000047259
Gene Name melanocortin 4 receptor
Synonyms Fatboy
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 66857715-66860472 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66859821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 74 (N74Y)
Ref Sequence ENSEMBL: ENSMUSP00000054776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057942]
AlphaFold P56450
Predicted Effect probably damaging
Transcript: ENSMUST00000057942
AA Change: N74Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: N74Y

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Meta Mutation Damage Score 0.9328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Mc4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.01
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense possibly damaging 0.61
Big_boned UTSW 18 66859488 missense probably damaging 1.00
Big_mac UTSW 18 66859856 missense probably damaging 1.00
blubbery UTSW 18 66859182 missense probably damaging 1.00
Cetacean UTSW 18 66859180 nonsense probably null
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
Leviathan UTSW 18 66860039 start codon destroyed probably null 0.49
southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66859847 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
R6161:Mc4r UTSW 18 66859180 nonsense probably null
R6802:Mc4r UTSW 18 66859417 missense probably benign 0.21
R6807:Mc4r UTSW 18 66859856 missense probably damaging 1.00
R6929:Mc4r UTSW 18 66859182 missense probably damaging 1.00
R7623:Mc4r UTSW 18 66859509 missense probably benign 0.32
R8292:Mc4r UTSW 18 66860011 nonsense probably null
R8560:Mc4r UTSW 18 66859095 missense possibly damaging 0.60
R8897:Mc4r UTSW 18 66859233 missense probably damaging 0.99
R8943:Mc4r UTSW 18 66860039 start codon destroyed probably null 0.49
Predicted Primers PCR Primer
(F):5'- AGGAGCTACAGATCACAGAGTC -3'
(R):5'- TGCAGGAAGATGAACTCCACC -3'

Sequencing Primer
(F):5'- GAGCTACAGATCACAGAGTCAATGAC -3'
(R):5'- ACCACCATGGCATGTATACTTC -3'
Posted On 2015-01-23