Incidental Mutation 'R3714:Ccdc87'
ID 259825
Institutional Source Beutler Lab
Gene Symbol Ccdc87
Ensembl Gene ENSMUSG00000067872
Gene Name coiled-coil domain containing 87
Synonyms
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 4839366-4842528 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4840259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 260 (S260G)
Ref Sequence ENSEMBL: ENSMUSP00000086028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037246] [ENSMUST00000088653]
AlphaFold Q8CDL9
Predicted Effect probably benign
Transcript: ENSMUST00000037246
SMART Domains Protein: ENSMUSP00000035486
Gene: ENSMUSG00000034108

DomainStartEndE-ValueType
Pfam:HMA 15 72 2.4e-12 PFAM
Pfam:Sod_Cu 93 230 6.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088653
AA Change: S260G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086028
Gene: ENSMUSG00000067872
AA Change: S260G

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 287 296 N/A INTRINSIC
low complexity region 326 341 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
Pfam:MAP65_ASE1 669 855 2.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Ccdc87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Ccdc87 APN 19 4841031 missense probably damaging 1.00
IGL02754:Ccdc87 APN 19 4839861 missense probably damaging 1.00
IGL03124:Ccdc87 APN 19 4841054 missense probably damaging 0.99
IGL03151:Ccdc87 APN 19 4841557 missense probably benign 0.01
R1572:Ccdc87 UTSW 19 4840313 missense probably benign 0.03
R2031:Ccdc87 UTSW 19 4841687 missense probably damaging 1.00
R3734:Ccdc87 UTSW 19 4841923 missense probably damaging 1.00
R3854:Ccdc87 UTSW 19 4839518 missense probably benign 0.36
R4643:Ccdc87 UTSW 19 4841849 missense probably damaging 1.00
R4820:Ccdc87 UTSW 19 4840551 missense probably damaging 1.00
R5039:Ccdc87 UTSW 19 4840401 splice site probably null
R5634:Ccdc87 UTSW 19 4840665 missense probably benign 0.00
R5659:Ccdc87 UTSW 19 4840850 missense probably damaging 0.99
R6065:Ccdc87 UTSW 19 4841240 missense probably benign
R6237:Ccdc87 UTSW 19 4841379 missense probably benign 0.15
R6337:Ccdc87 UTSW 19 4839801 missense probably benign 0.00
R6349:Ccdc87 UTSW 19 4841319 missense probably damaging 1.00
R6429:Ccdc87 UTSW 19 4841235 missense probably benign 0.06
R6520:Ccdc87 UTSW 19 4841789 missense probably damaging 0.99
R7131:Ccdc87 UTSW 19 4841757 missense probably damaging 1.00
R7237:Ccdc87 UTSW 19 4839762 missense probably benign 0.00
R7349:Ccdc87 UTSW 19 4841840 missense probably damaging 0.98
R7848:Ccdc87 UTSW 19 4841508 missense probably damaging 1.00
R8382:Ccdc87 UTSW 19 4839990 missense possibly damaging 0.88
R8421:Ccdc87 UTSW 19 4841285 missense possibly damaging 0.79
R8560:Ccdc87 UTSW 19 4841873 missense probably damaging 1.00
R8747:Ccdc87 UTSW 19 4841618 missense probably benign 0.01
Z1088:Ccdc87 UTSW 19 4840722 missense probably benign 0.02
Z1176:Ccdc87 UTSW 19 4841923 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTAAAGCACGCCCAGGGAG -3'
(R):5'- CCTCATGAAGACAAGGCATGG -3'

Sequencing Primer
(F):5'- GGCATAGTCAAATTGCGTCC -3'
(R):5'- ATGGACTGGCCCCTTTGGAG -3'
Posted On 2015-01-23