Incidental Mutation 'R3714:Vps37c'
ID 259827
Institutional Source Beutler Lab
Gene Symbol Vps37c
Ensembl Gene ENSMUSG00000048832
Gene Name vacuolar protein sorting 37C
Synonyms
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R3714 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 10688815-10714419 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10706268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 18 (D18G)
Ref Sequence ENSEMBL: ENSMUSP00000085264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087951]
AlphaFold Q8R105
Predicted Effect probably damaging
Transcript: ENSMUST00000087951
AA Change: D18G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085264
Gene: ENSMUSG00000048832
AA Change: D18G

DomainStartEndE-ValueType
Pfam:Mod_r 5 150 2.4e-39 PFAM
low complexity region 171 216 N/A INTRINSIC
low complexity region 233 250 N/A INTRINSIC
low complexity region 310 338 N/A INTRINSIC
Meta Mutation Damage Score 0.3529 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VPS37C is a subunit of ESCRT-I (endosomal sorting complex required for transport I), a complex in the class E vacuolar protein sorting (VPS) pathway required for sorting ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies (Eastman et al., 2005 [PubMed 15509564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Other mutations in Vps37c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Vps37c APN 19 10710417 missense probably damaging 0.99
R0433:Vps37c UTSW 19 10713029 missense probably benign
R2348:Vps37c UTSW 19 10706300 missense probably damaging 1.00
R2483:Vps37c UTSW 19 10706205 splice site probably null
R3623:Vps37c UTSW 19 10706205 splice site probably null
R4650:Vps37c UTSW 19 10712909 missense probably benign 0.31
R4684:Vps37c UTSW 19 10712768 missense probably benign
R7000:Vps37c UTSW 19 10710329 missense probably damaging 1.00
R7026:Vps37c UTSW 19 10706268 missense probably damaging 1.00
R7779:Vps37c UTSW 19 10712624 missense probably damaging 1.00
R8406:Vps37c UTSW 19 10710355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGTGACTGCCAAGTAG -3'
(R):5'- ATGACCTCTCTGGGTTCCTG -3'

Sequencing Primer
(F):5'- CTGTGACTGCCAAGTAGTTTTACAG -3'
(R):5'- CCAGTGCACATTCATATATATGCC -3'
Posted On 2015-01-23