Incidental Mutation 'R3714:Lipk'
ID 259828
Institutional Source Beutler Lab
Gene Symbol Lipk
Ensembl Gene ENSMUSG00000024771
Gene Name lipase, family member K
Synonyms Lipl2
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R3714 (G1)
Quality Score 90
Status Not validated
Chromosome 19
Chromosomal Location 34008290-34047835 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34040429 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 289 (N289S)
Ref Sequence ENSEMBL: ENSMUSP00000152955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054260] [ENSMUST00000224738] [ENSMUST00000225505]
AlphaFold Q8BM14
Predicted Effect possibly damaging
Transcript: ENSMUST00000054260
AA Change: N294S

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053913
Gene: ENSMUSG00000024771
AA Change: N294S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 39 101 2.8e-26 PFAM
Pfam:Hydrolase_4 78 263 7.1e-10 PFAM
Pfam:Abhydrolase_5 82 377 7.1e-11 PFAM
Pfam:Abhydrolase_1 82 383 8.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224738
Predicted Effect probably damaging
Transcript: ENSMUST00000225505
AA Change: N289S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.1701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Lipk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Lipk APN 19 34039148 missense probably damaging 1.00
IGL02538:Lipk APN 19 34046879 missense probably damaging 0.99
IGL03015:Lipk APN 19 34018708 missense probably benign
R0240:Lipk UTSW 19 34046810 missense probably benign 0.00
R0240:Lipk UTSW 19 34046810 missense probably benign 0.00
R1456:Lipk UTSW 19 34046785 missense probably damaging 1.00
R1822:Lipk UTSW 19 34039091 missense probably benign 0.01
R2149:Lipk UTSW 19 34021617 missense possibly damaging 0.79
R2988:Lipk UTSW 19 34021737 missense probably damaging 1.00
R3715:Lipk UTSW 19 34040429 missense probably damaging 0.99
R3741:Lipk UTSW 19 34021707 missense probably damaging 1.00
R4229:Lipk UTSW 19 34020287 missense probably damaging 1.00
R4720:Lipk UTSW 19 34021699 missense probably damaging 1.00
R4837:Lipk UTSW 19 34032320 missense probably damaging 1.00
R5329:Lipk UTSW 19 34020213 splice site probably null
R5661:Lipk UTSW 19 34032327 missense probably benign 0.41
R5887:Lipk UTSW 19 34039107 missense possibly damaging 0.67
R6967:Lipk UTSW 19 34040394 nonsense probably null
R8465:Lipk UTSW 19 34046797 missense probably benign 0.04
R8724:Lipk UTSW 19 34018720 missense probably benign 0.00
R8747:Lipk UTSW 19 34018784 missense probably damaging 1.00
R9136:Lipk UTSW 19 34022430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTATAGAGGCCCTCTTTGG -3'
(R):5'- CCTACACGGAACTCTCTGGAAC -3'

Sequencing Primer
(F):5'- CTGTCAGCTAAGGACTAGATTATGG -3'
(R):5'- ACGGAACTCTCTGGAACTATACTTC -3'
Posted On 2015-01-23