Incidental Mutation 'R3715:Olfr1211'
ID259833
Institutional Source Beutler Lab
Gene Symbol Olfr1211
Ensembl Gene ENSMUSG00000075112
Gene Nameolfactory receptor 1211
SynonymsMOR233-21, MOR233-16P, GA_x6K02T2Q125-50409367-50408432
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88926876-88938111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88929413 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 301 (W301R)
Ref Sequence ENSEMBL: ENSMUSP00000150571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099808] [ENSMUST00000213412] [ENSMUST00000215205]
Predicted Effect probably benign
Transcript: ENSMUST00000099808
AA Change: W301R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097396
Gene: ENSMUSG00000075112
AA Change: W301R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.5e-49 PFAM
Pfam:7tm_1 39 286 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141958
Predicted Effect probably benign
Transcript: ENSMUST00000213412
AA Change: W301R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215205
AA Change: W301R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.7247 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Olfr1211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Olfr1211 APN 2 88929448 missense probably damaging 1.00
IGL02936:Olfr1211 APN 2 88929784 missense probably benign 0.01
IGL02960:Olfr1211 APN 2 88929784 missense possibly damaging 0.80
IGL02989:Olfr1211 APN 2 88929704 missense possibly damaging 0.72
R0193:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R0413:Olfr1211 UTSW 2 88929562 missense probably benign 0.16
R1644:Olfr1211 UTSW 2 88929387 missense probably benign 0.01
R4019:Olfr1211 UTSW 2 88929736 missense probably benign 0.02
R4722:Olfr1211 UTSW 2 88929980 missense possibly damaging 0.91
R4751:Olfr1211 UTSW 2 88929914 missense probably damaging 1.00
R4859:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R5053:Olfr1211 UTSW 2 88930253 missense probably benign 0.02
R6148:Olfr1211 UTSW 2 88930253 missense probably benign 0.00
R7064:Olfr1211 UTSW 2 88929509 missense probably benign 0.00
R7527:Olfr1211 UTSW 2 88930090 missense probably benign 0.00
R7584:Olfr1211 UTSW 2 88929805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCCAGCTAAGAATTGATACTC -3'
(R):5'- TGGAAAGCTCTCTCCACATG -3'

Sequencing Primer
(F):5'- GATGGTTTGCTAGTGCCA -3'
(R):5'- TGGATCCCACATTGCAGTTG -3'
Posted On2015-01-23