Incidental Mutation 'R3715:Tmem82'
ID259842
Institutional Source Beutler Lab
Gene Symbol Tmem82
Ensembl Gene ENSMUSG00000043085
Gene Nametransmembrane protein 82
Synonyms
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141613376-141618633 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 141617634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038661] [ENSMUST00000053263] [ENSMUST00000143154]
Predicted Effect probably benign
Transcript: ENSMUST00000038661
SMART Domains Protein: ENSMUSP00000039188
Gene: ENSMUSG00000040740

DomainStartEndE-ValueType
Pfam:Mito_carr 16 111 2.2e-14 PFAM
Pfam:Mito_carr 113 213 7.6e-18 PFAM
Pfam:Mito_carr 217 314 9.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053263
SMART Domains Protein: ENSMUSP00000058412
Gene: ENSMUSG00000043085

DomainStartEndE-ValueType
Pfam:TMEM82 10 315 2.4e-137 PFAM
low complexity region 342 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140726
Predicted Effect probably benign
Transcript: ENSMUST00000143154
SMART Domains Protein: ENSMUSP00000120973
Gene: ENSMUSG00000043085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 203 222 N/A INTRINSIC
transmembrane domain 232 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156246
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Tmem82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Tmem82 APN 4 141614643 missense probably benign
R0456:Tmem82 UTSW 4 141617390 missense probably benign 0.00
R1473:Tmem82 UTSW 4 141616278 missense possibly damaging 0.95
R2094:Tmem82 UTSW 4 141616287 missense probably benign 0.00
R2902:Tmem82 UTSW 4 141616464 missense probably benign 0.17
R4728:Tmem82 UTSW 4 141614652 missense probably benign
R6332:Tmem82 UTSW 4 141616410 missense probably damaging 0.99
R7171:Tmem82 UTSW 4 141614973 missense possibly damaging 0.60
R7282:Tmem82 UTSW 4 141614950 missense possibly damaging 0.80
R7404:Tmem82 UTSW 4 141617431 missense possibly damaging 0.94
R7593:Tmem82 UTSW 4 141616294 missense probably damaging 0.99
R7790:Tmem82 UTSW 4 141617724 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCAACGAGGCCCATTG -3'
(R):5'- CTCTTCGACAGCCTTCTGCAAG -3'

Sequencing Primer
(F):5'- CCATTGCGCGCTCAGCC -3'
(R):5'- AGTCTCGGTTCTCAACAG -3'
Posted On2015-01-23