Incidental Mutation 'R3715:Arntl2'
ID259845
Institutional Source Beutler Lab
Gene Symbol Arntl2
Ensembl Gene ENSMUSG00000040187
Gene Namearyl hydrocarbon receptor nuclear translocator-like 2
SynonymsMOP9, 4632430A05Rik, bHLHe6, BMAL2
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146796055-146833529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146822689 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 360 (K360E)
Ref Sequence ENSEMBL: ENSMUSP00000107266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080530] [ENSMUST00000111636] [ENSMUST00000111638] [ENSMUST00000111639] [ENSMUST00000129788]
Predicted Effect probably damaging
Transcript: ENSMUST00000080530
AA Change: K360E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079373
Gene: ENSMUSG00000040187
AA Change: K360E

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111636
AA Change: K360E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107263
Gene: ENSMUSG00000040187
AA Change: K360E

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111638
AA Change: K360E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107265
Gene: ENSMUSG00000040187
AA Change: K360E

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 1.29e-4 SMART
PAC 361 404 3.66e0 SMART
low complexity region 417 428 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111639
AA Change: K360E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107266
Gene: ENSMUSG00000040187
AA Change: K360E

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129788
SMART Domains Protein: ENSMUSP00000121170
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203818
Meta Mutation Damage Score 0.2227 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (Per, Arnt, Sim) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian Clock protein, the structurally related Mop4, and hypoxia-inducible factors, such as Hif1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Arntl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Arntl2 APN 6 146827329 splice site probably benign
IGL00481:Arntl2 APN 6 146809666 missense probably benign 0.11
IGL02141:Arntl2 APN 6 146828095 splice site probably benign
IGL02402:Arntl2 APN 6 146809768 missense possibly damaging 0.90
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0131:Arntl2 UTSW 6 146828103 missense probably benign 0.00
R0403:Arntl2 UTSW 6 146822655 missense probably damaging 1.00
R0716:Arntl2 UTSW 6 146829720 missense possibly damaging 0.82
R0799:Arntl2 UTSW 6 146823253 splice site probably benign
R0834:Arntl2 UTSW 6 146822687 missense probably damaging 1.00
R1909:Arntl2 UTSW 6 146810810 missense probably benign 0.01
R2270:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R2272:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R4370:Arntl2 UTSW 6 146809651 missense probably damaging 1.00
R5399:Arntl2 UTSW 6 146822661 missense probably damaging 0.99
R5894:Arntl2 UTSW 6 146823234 missense possibly damaging 0.93
R5972:Arntl2 UTSW 6 146809689 missense probably damaging 0.99
R6090:Arntl2 UTSW 6 146829696 missense possibly damaging 0.90
R6111:Arntl2 UTSW 6 146820599 missense probably benign 0.16
R6279:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6300:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6452:Arntl2 UTSW 6 146823207 missense probably benign 0.00
R6722:Arntl2 UTSW 6 146818900 missense probably damaging 0.99
R7296:Arntl2 UTSW 6 146822134 missense not run
R7335:Arntl2 UTSW 6 146809719 missense probably benign 0.01
R7481:Arntl2 UTSW 6 146818871 missense not run
R7655:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R7656:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R7951:Arntl2 UTSW 6 146813234 missense probably damaging 1.00
R8015:Arntl2 UTSW 6 146820590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTCTTTCTCCAGACGGC -3'
(R):5'- TTCATAAGGAATTCGGAGTTGATGG -3'

Sequencing Primer
(F):5'- AGACGGCTTTCCTGCAAC -3'
(R):5'- AGGAATTCGGAGTTGATGGTATAATC -3'
Posted On2015-01-23